ID: 937927632

View in Genome Browser
Species Human (GRCh38)
Location 2:127179428-127179450
Sequence GAACCTGAGAATACGCTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937927632_937927642 12 Left 937927632 2:127179428-127179450 CCATCTAGCGTATTCTCAGGTTC No data
Right 937927642 2:127179463-127179485 TGTGGGCATCTTTGGGGCAGGGG No data
937927632_937927638 5 Left 937927632 2:127179428-127179450 CCATCTAGCGTATTCTCAGGTTC No data
Right 937927638 2:127179456-127179478 ACTAGGATGTGGGCATCTTTGGG No data
937927632_937927640 10 Left 937927632 2:127179428-127179450 CCATCTAGCGTATTCTCAGGTTC No data
Right 937927640 2:127179461-127179483 GATGTGGGCATCTTTGGGGCAGG No data
937927632_937927636 -5 Left 937927632 2:127179428-127179450 CCATCTAGCGTATTCTCAGGTTC No data
Right 937927636 2:127179446-127179468 GGTTCTGGAGACTAGGATGTGGG No data
937927632_937927641 11 Left 937927632 2:127179428-127179450 CCATCTAGCGTATTCTCAGGTTC No data
Right 937927641 2:127179462-127179484 ATGTGGGCATCTTTGGGGCAGGG No data
937927632_937927643 13 Left 937927632 2:127179428-127179450 CCATCTAGCGTATTCTCAGGTTC No data
Right 937927643 2:127179464-127179486 GTGGGCATCTTTGGGGCAGGGGG No data
937927632_937927635 -6 Left 937927632 2:127179428-127179450 CCATCTAGCGTATTCTCAGGTTC No data
Right 937927635 2:127179445-127179467 AGGTTCTGGAGACTAGGATGTGG No data
937927632_937927639 6 Left 937927632 2:127179428-127179450 CCATCTAGCGTATTCTCAGGTTC No data
Right 937927639 2:127179457-127179479 CTAGGATGTGGGCATCTTTGGGG No data
937927632_937927637 4 Left 937927632 2:127179428-127179450 CCATCTAGCGTATTCTCAGGTTC No data
Right 937927637 2:127179455-127179477 GACTAGGATGTGGGCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937927632 Original CRISPR GAACCTGAGAATACGCTAGA TGG (reversed) Intergenic
No off target data available for this crispr