ID: 937927641

View in Genome Browser
Species Human (GRCh38)
Location 2:127179462-127179484
Sequence ATGTGGGCATCTTTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937927632_937927641 11 Left 937927632 2:127179428-127179450 CCATCTAGCGTATTCTCAGGTTC No data
Right 937927641 2:127179462-127179484 ATGTGGGCATCTTTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937927641 Original CRISPR ATGTGGGCATCTTTGGGGCA GGG Intergenic
No off target data available for this crispr