ID: 937927899

View in Genome Browser
Species Human (GRCh38)
Location 2:127182064-127182086
Sequence CACTCCCACCCTAGGCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 343}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937927899_937927907 -6 Left 937927899 2:127182064-127182086 CCTGAGAGCCTAGGGTGGGAGTG 0: 1
1: 0
2: 3
3: 42
4: 343
Right 937927907 2:127182081-127182103 GGAGTGGGGTAGGGCAAGGCAGG 0: 1
1: 0
2: 6
3: 105
4: 990
937927899_937927910 28 Left 937927899 2:127182064-127182086 CCTGAGAGCCTAGGGTGGGAGTG 0: 1
1: 0
2: 3
3: 42
4: 343
Right 937927910 2:127182115-127182137 TCAACGGCACCCAGCCCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 234
937927899_937927909 12 Left 937927899 2:127182064-127182086 CCTGAGAGCCTAGGGTGGGAGTG 0: 1
1: 0
2: 3
3: 42
4: 343
Right 937927909 2:127182099-127182121 GCAGGAAACAGAGAGGTCAACGG 0: 1
1: 0
2: 6
3: 76
4: 595
937927899_937927908 5 Left 937927899 2:127182064-127182086 CCTGAGAGCCTAGGGTGGGAGTG 0: 1
1: 0
2: 3
3: 42
4: 343
Right 937927908 2:127182092-127182114 GGGCAAGGCAGGAAACAGAGAGG 0: 1
1: 0
2: 5
3: 62
4: 640
937927899_937927906 -10 Left 937927899 2:127182064-127182086 CCTGAGAGCCTAGGGTGGGAGTG 0: 1
1: 0
2: 3
3: 42
4: 343
Right 937927906 2:127182077-127182099 GGTGGGAGTGGGGTAGGGCAAGG 0: 1
1: 2
2: 9
3: 206
4: 1596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937927899 Original CRISPR CACTCCCACCCTAGGCTCTC AGG (reversed) Intergenic
900244380 1:1630714-1630736 CCCGCCCGCCCCAGGCTCTCGGG + Intergenic
900622206 1:3592651-3592673 CCCTCCCACCCTTGGGGCTCAGG + Intronic
900759996 1:4463943-4463965 GACTCCCACCCGAGGGTCACAGG - Intergenic
900791484 1:4683818-4683840 AAGTCCCACCCTGGCCTCTCTGG - Intronic
901038025 1:6348065-6348087 CACCCCTGCCCCAGGCTCTCAGG + Intronic
902397707 1:16141576-16141598 CGTTCCCAGCCCAGGCTCTCAGG + Intronic
902414089 1:16228881-16228903 CAGTCCCACCCTTGCCTCTCAGG + Intergenic
903349592 1:22710177-22710199 CAGCCCCACCCCAGGCCCTCGGG + Intergenic
903521967 1:23957781-23957803 TTCTCCCACCTTAGTCTCTCAGG + Intergenic
903809173 1:26025179-26025201 CACTCTGTCCCTAGGCTGTCTGG - Intronic
903913322 1:26744843-26744865 CTCTCTCACCCTAAGCTCTGAGG - Intronic
903973216 1:27132767-27132789 AACTCCCACCCTAGGCCAACAGG + Intronic
904041435 1:27587327-27587349 CTCTCCCAGCCTAGCCTCTGAGG + Intronic
904602201 1:31679842-31679864 CACTCCCACCCAGGGTGCTCCGG - Exonic
904740522 1:32671783-32671805 CTCTCCCACCTTAGCCTCCCAGG - Intronic
905426919 1:37893187-37893209 TCCTCCCACCTCAGGCTCTCTGG + Intronic
906068872 1:43002904-43002926 CACTCCCTCCCCAGACTCTTGGG + Intergenic
906616406 1:47235603-47235625 CACCCCCACCCCAGGCGCTCCGG - Intergenic
906656846 1:47554409-47554431 CACTGCCTCCCTAGGCTGCCTGG + Intergenic
906799530 1:48724033-48724055 CATACCCACCTTTGGCTCTCTGG - Intronic
907385325 1:54122087-54122109 CACCCCCACCTTGGGCTGTCAGG + Intergenic
907585649 1:55615520-55615542 TACTCCCTCCCAAGGCTCTAGGG - Intergenic
909477959 1:76103661-76103683 CACTCCCTCCAAAGGCTCTAGGG + Intronic
910547389 1:88433360-88433382 CACTGCCACCATAGGCCCTGGGG - Intergenic
911180575 1:94856804-94856826 CACTCCTACCCTCGCCTCCCAGG + Intronic
911838547 1:102652176-102652198 CACTCTCTCCAGAGGCTCTCGGG + Intergenic
915265273 1:154712333-154712355 CACTCCCACCCCAGGCTCCTAGG + Intronic
915548405 1:156616979-156617001 CCCTCCCACCTCAGCCTCTCAGG - Intergenic
915951078 1:160190363-160190385 CACTTCTACCCCAGGCTCCCAGG - Intergenic
916056166 1:161069973-161069995 CTCCCCCACCCTAGGCCCTGTGG - Intergenic
916641247 1:166730417-166730439 CACTCCCAAGCTATGCTCTGGGG - Intergenic
918009045 1:180569470-180569492 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
918241041 1:182620588-182620610 CACTGCAACCCTTGCCTCTCAGG + Intergenic
918802328 1:188987187-188987209 CACTACCTCCCTTGGCTGTCAGG + Intergenic
918986058 1:191628116-191628138 TCCTCCCACCTAAGGCTCTCAGG - Intergenic
919165991 1:193893409-193893431 CTCTCCAAACCTAGGCTTTCTGG + Intergenic
920070761 1:203301439-203301461 CACTCCCACCCAAGGGTCTTGGG - Intergenic
920340422 1:205272134-205272156 CACACCAACCCTGTGCTCTCTGG + Exonic
920436961 1:205953294-205953316 CACCCCCACCCCAGTCTCCCTGG - Intergenic
920669701 1:207993852-207993874 CACTCCCTCCGATGGCTCTCTGG - Intergenic
921354945 1:214277104-214277126 CACTCCCTCCCGAGGCTCTAGGG + Intergenic
921870640 1:220135930-220135952 CACTCCCACCCCAGGGCCCCTGG + Intronic
922560386 1:226565228-226565250 CACTCCCACCCTTGGGCCTGAGG - Intronic
924314024 1:242776940-242776962 CCCTCCCACCCTCTGCTCTCAGG - Intergenic
924553314 1:245098303-245098325 CACTCCAACCCCAGGCTCTCCGG - Intronic
1063590495 10:7391022-7391044 CACTGCAACCTTAGCCTCTCAGG - Intronic
1063868960 10:10397712-10397734 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1065013269 10:21438781-21438803 TCCTCCCACCTTAGCCTCTCAGG + Intergenic
1067083048 10:43222399-43222421 CACTCCCACCCCCAGCTCTAGGG + Intronic
1067916618 10:50406810-50406832 CACTCCCACCTCAGCCTCCCAGG + Intronic
1068525770 10:58127724-58127746 CACTCCCTCCAGAGGCTCTATGG + Intergenic
1069513116 10:69056810-69056832 CACACCCACCCTGGGTTGTCTGG + Intergenic
1070406955 10:76105660-76105682 CACTCCCTCCAAAGGCTCTAGGG - Intronic
1071734579 10:88283805-88283827 CCCTCCCACCCTCTACTCTCAGG - Intronic
1072661121 10:97364089-97364111 CCTTCCCACCCTAGGCCCTAGGG + Intronic
1073408178 10:103317084-103317106 CACTGCAACCCTTGCCTCTCAGG + Intronic
1073462447 10:103673885-103673907 CATCCCCACCCTGGGCTCTGGGG + Intronic
1073571064 10:104581555-104581577 CAAGGCCACTCTAGGCTCTCTGG - Intergenic
1075452563 10:122562295-122562317 CACTCTCCCCCTAGGCTCAGTGG + Intronic
1076534348 10:131167323-131167345 CACTCCCACCCTGGGCCCACTGG - Intronic
1076696594 10:132250171-132250193 CAGTGCCACCCTGGGCTCTGCGG - Intronic
1077184291 11:1229407-1229429 CCTTCCCACCCTGGGCCCTCTGG - Intronic
1077185421 11:1233538-1233560 CACTCCCACCCTGGGCTCAAAGG + Intronic
1077400167 11:2351714-2351736 AACTCCCACCCTAGGGTATCTGG - Intergenic
1078151862 11:8766362-8766384 CAGCCTCACCCTAGGCTCCCAGG + Intronic
1078933174 11:15928837-15928859 GACTCCTTCCCGAGGCTCTCAGG - Intergenic
1079454464 11:20624712-20624734 CAGGCCCACTCTGGGCTCTCGGG - Intronic
1081763731 11:45594777-45594799 CCCTCCCACCCCAGGCTCTGAGG + Intergenic
1081771935 11:45655610-45655632 CACCCCCACCCTAGCCGCACCGG + Intronic
1082711716 11:56560963-56560985 CACTCCCATCATAGGCTCAGAGG + Intergenic
1083827308 11:65211009-65211031 CACCCCCACCCCAGCCTTTCAGG - Intronic
1083925162 11:65801648-65801670 CTCTCCCACCTTAGGCTCCAGGG + Intergenic
1084651187 11:70490395-70490417 GCGTCTCACCCTAGGCTCTCTGG - Intronic
1084727410 11:70950681-70950703 CACTGCCACCTTTGCCTCTCAGG + Intronic
1084785232 11:71438176-71438198 CTCTCCCAGCCCAGGTTCTCAGG + Intronic
1088250072 11:107854930-107854952 CTCTCCCACCCTTGGTTCCCTGG + Intronic
1088536123 11:110863635-110863657 CACTACCTCCATAGGCTCTAGGG + Intergenic
1089292817 11:117448609-117448631 CACACACATTCTAGGCTCTCAGG - Intronic
1089295570 11:117465182-117465204 CACCCCCACCCCATGCTCACAGG - Exonic
1089387889 11:118079855-118079877 CAGTGCCATCCTAGGCTCTGAGG + Intronic
1089959112 11:122600054-122600076 GACTCCCACCCCAGACTTTCTGG + Intergenic
1090086385 11:123654390-123654412 CACGCCCGCCCTCGGCTCCCTGG + Exonic
1090243682 11:125201141-125201163 CAGCCCCAGCCTAAGCTCTCAGG - Intronic
1090603463 11:128396261-128396283 CATTGCCACCCTGGGTTCTCAGG + Intergenic
1090804423 11:130194072-130194094 CACACCCAAACCAGGCTCTCAGG - Intronic
1090977063 11:131687625-131687647 CACTCCCACCCGAGGCACTTGGG - Intronic
1091103188 11:132894820-132894842 CACTCCTACCCCAGGTTTTCAGG + Intronic
1091103828 11:132899923-132899945 CACTCCCACCCCAGGATCTCAGG + Intronic
1091657889 12:2359173-2359195 CACTCCTTCCCTTTGCTCTCTGG + Intronic
1092209550 12:6637503-6637525 CACTCCTACCTCAGCCTCTCAGG - Intergenic
1092537309 12:9402673-9402695 CCCTCCCACCCCCGGCTCTTAGG + Intergenic
1092557370 12:9570625-9570647 CCCTCCCACCCCCGGCTCTTAGG - Intergenic
1093801852 12:23383061-23383083 CACTCACACCCGAAGCTCTAGGG - Intergenic
1094513908 12:31117284-31117306 CCCTCCCACCCCCGGCTCTTAGG + Intergenic
1094514284 12:31118518-31118540 CCCTCCCACCCCCGGCTCTTAGG + Intergenic
1096847804 12:54417713-54417735 CACCCCAACCCCAGGATCTCAGG - Intronic
1097742667 12:63262348-63262370 GACTACCACCCTAGTCTGTCAGG - Intergenic
1099276383 12:80581525-80581547 CCCTCCCAACCCAGTCTCTCGGG - Intronic
1100371059 12:93969061-93969083 CACTCCCTCCAGGGGCTCTCGGG + Intergenic
1101308755 12:103556977-103556999 CACTCCCTCCAAAGGCTCTGTGG - Intergenic
1101407325 12:104440307-104440329 CACACCAACCCTAGGCTGTGAGG + Intergenic
1101654830 12:106710707-106710729 CACTCCCAGGCTGGGCTCCCTGG - Intronic
1102183679 12:110931785-110931807 CACTCTCATCCTGGGCTCTATGG + Intergenic
1103508979 12:121461162-121461184 CACTCCCACCCCTGGCACGCAGG - Intronic
1103840906 12:123863509-123863531 CACTCCCTCCGAAGGCTCTAGGG + Intronic
1103959828 12:124602480-124602502 CCTTCCCACCTTAGCCTCTCTGG + Intergenic
1104018228 12:124974535-124974557 CAGGCCCATCCTGGGCTCTCAGG - Intronic
1107015453 13:35705224-35705246 CAACCCCACCCTATCCTCTCTGG - Intergenic
1108052539 13:46460581-46460603 CTCTCCCACCCCTGGCTCTTAGG + Intergenic
1111604407 13:90519508-90519530 CACTTCCTGCCTTGGCTCTCGGG + Intergenic
1112364561 13:98745668-98745690 CACTCCCTCCGAAGGCTCTGGGG - Intronic
1112733675 13:102394644-102394666 CGCTCCCAGCCTCGGCTCGCCGG - Intronic
1114549643 14:23525517-23525539 CACCCCCACCTGAGGCCCTCGGG - Exonic
1114628194 14:24142998-24143020 AATCCCCACCCTAGGCACTCAGG + Intergenic
1115546171 14:34466546-34466568 CAGTCCCACCCCCAGCTCTCTGG + Intergenic
1116394725 14:44433748-44433770 TGCTCTCTCCCTAGGCTCTCTGG + Intergenic
1116713273 14:48396884-48396906 CACTCCCATCATAGGCTCAGAGG + Intergenic
1117222199 14:53617294-53617316 CACTCCCACCCCACCCCCTCAGG - Intergenic
1117401125 14:55359064-55359086 CACTCCCAGCATAGTCTCTCTGG + Intronic
1117483073 14:56168448-56168470 CACTGCCACCCTAGGCCATGAGG + Intronic
1119816967 14:77578035-77578057 TTCTCCCACCTTAGCCTCTCTGG - Intronic
1120210847 14:81632363-81632385 TCCTCCCACCCTGGGTTCTCAGG - Intergenic
1121076184 14:91070291-91070313 CCCTGTCACTCTAGGCTCTCTGG - Intronic
1121676845 14:95760424-95760446 CCCTCCCACCACAGTCTCTCTGG - Intergenic
1122112411 14:99511656-99511678 CACTGCCTCCCAAGGCACTCTGG + Exonic
1122190967 14:100043454-100043476 CACCCCCACCCTGGGCTCACAGG - Intronic
1122691623 14:103534454-103534476 GACTCCCACCCTAGGGTCTGAGG - Intronic
1122854895 14:104555265-104555287 CCCTCCCAGCCTGGGCTCCCTGG - Intronic
1123053819 14:105560061-105560083 AACCCCCACCCTGGGCTGTCTGG - Intergenic
1123078402 14:105680478-105680500 AACCCCCACCCTGGGCTGTCTGG - Intergenic
1125715551 15:41817909-41817931 CACTCCCAGTCTACACTCTCTGG - Intronic
1127433055 15:58930603-58930625 CCCTCCCACCTTAGCCTCCCTGG - Intronic
1127963649 15:63908242-63908264 CACTCCCACCCCAGACTCTGAGG + Exonic
1128309312 15:66620655-66620677 TACCCCCTCCCCAGGCTCTCAGG - Intronic
1128354162 15:66912870-66912892 CACTCCCACTCTCCGCCCTCTGG - Intergenic
1128520200 15:68370093-68370115 CACTCCCTCCGCAGGCTCTGGGG - Intronic
1129119352 15:73386318-73386340 CTCTCCCATCCTAGGCACTTTGG + Intergenic
1129505566 15:76078875-76078897 CACTCCCTGCATAGGCTCTGGGG + Intronic
1130242736 15:82211609-82211631 CACACACACACTAGACTCTCTGG + Intronic
1130322227 15:82850828-82850850 CACCCTGACCCTGGGCTCTCAGG + Intronic
1130326033 15:82880914-82880936 CACACTCACCCTTGGCTCCCAGG - Intronic
1132517110 16:371019-371041 CCCTCCTACCCTTGGCTCTGGGG - Exonic
1132880211 16:2158783-2158805 CACTGCCACCCTTGGCTCTTGGG + Intronic
1132939873 16:2501305-2501327 TACTCCCACCCCAGGGGCTCAGG - Exonic
1134017679 16:10900630-10900652 TTCTCCCACCCTAGCCTCCCTGG - Intronic
1134621201 16:15690881-15690903 CACTGCCACCCTGGCCTCCCAGG + Intronic
1135458979 16:22624571-22624593 CACTCCCATCCTCGGCTGGCGGG + Intergenic
1135732351 16:24905544-24905566 CACTGCAACCCTAGCCTCACAGG - Intronic
1136016760 16:27405694-27405716 CACCCCCACCCCTGGCTCACAGG + Intronic
1139573091 16:67825539-67825561 CACTACCAGCCTAGGGTTTCAGG - Intronic
1139839194 16:69864623-69864645 CACTGCCACCTTGGCCTCTCGGG + Intronic
1140455000 16:75099879-75099901 CACTTCCCTGCTAGGCTCTCAGG + Intronic
1141762172 16:86035836-86035858 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1141897897 16:86970360-86970382 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1142606938 17:1087295-1087317 TACCCCCACCCCAGCCTCTCTGG - Intronic
1143651245 17:8265358-8265380 CACTGCCACCATAGCCTCACAGG - Exonic
1143651664 17:8267224-8267246 CACTCCCTCACCAGGCTCACGGG - Exonic
1143855590 17:9845616-9845638 CTCTCCCTCCCTGGCCTCTCTGG + Intronic
1144038033 17:11384802-11384824 AACTCCCACCCTCGTCTATCTGG - Intronic
1144038517 17:11388159-11388181 CACTCACTCCCCTGGCTCTCCGG - Intronic
1144387495 17:14762983-14763005 CACTTCCACCTTTGGCTTTCTGG + Intergenic
1144849276 17:18235842-18235864 CAGGCCCACGCTGGGCTCTCTGG - Intronic
1145822520 17:27850267-27850289 CACTGCAACCCTCGCCTCTCAGG - Intronic
1146116106 17:30140602-30140624 CACTGCAACCCTTGCCTCTCAGG + Intronic
1146615922 17:34357321-34357343 CACTCCCACCCTAGACCCTGAGG - Intronic
1146638321 17:34522107-34522129 CACTCCCACCCCAGGATTTATGG - Intergenic
1146969260 17:37059241-37059263 CCCTCCCACCTCAGCCTCTCAGG + Intergenic
1147178380 17:38670599-38670621 AACTCCCTCCGAAGGCTCTCGGG - Intergenic
1147978101 17:44259374-44259396 CACACCCACCCTGGGCTCCTCGG - Intronic
1149002347 17:51770406-51770428 CCCTCCAAGCCTAGGGTCTCGGG - Intronic
1149897287 17:60438216-60438238 CACTCCCACCCCAGTCTCTCAGG + Intergenic
1150179530 17:63102201-63102223 CACTCCCACCGTAGCCTCCTTGG - Intronic
1151703201 17:75754028-75754050 GACGCCCACCCCAGGCCCTCAGG - Intronic
1151999217 17:77634872-77634894 CACTCCCTCTCGAGGCTCTAGGG + Intergenic
1152743373 17:82028331-82028353 CGCGCCCACCCTGGGCTCCCTGG - Intronic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1156302287 18:35846318-35846340 GACTCCTTCCCAAGGCTCTCTGG + Intergenic
1156619328 18:38830481-38830503 CTCTCCCTCCCTAGGCCTTCTGG - Intergenic
1158183774 18:54747996-54748018 TCCTCCCACCCTAGCCTCCCAGG - Intronic
1158542154 18:58366870-58366892 CACTCCAGCCCTGGGCTCTAAGG + Intronic
1160620039 18:80164203-80164225 CACTCCCTGCTTAGTCTCTCTGG - Intronic
1160762382 19:791995-792017 CACCCCCACCCTGGGCCCTCAGG - Intergenic
1161051129 19:2164459-2164481 CGCTCCCACCCCAGGCGCGCGGG - Intronic
1161857606 19:6774508-6774530 CACTGCAACCTTAGCCTCTCAGG + Intronic
1162942118 19:14017242-14017264 CACTGCAACCCTCGCCTCTCGGG - Intergenic
1163034532 19:14563301-14563323 CCCTCCCACCCTAAGGTCCCTGG - Intronic
1163153177 19:15426887-15426909 CAATTCAACCCTAGGCACTCTGG + Intronic
1163376493 19:16936001-16936023 CACTGCCACCTCAGCCTCTCAGG + Intronic
1164788454 19:30956462-30956484 CAGTCCCAGCCTAAGCTCTCAGG + Intergenic
1166382496 19:42362292-42362314 CCCACCCACCCCAGGGTCTCAGG + Intronic
1166383716 19:42369027-42369049 CTCTCCCACCCTAGCCTGCCTGG - Intronic
925042105 2:740193-740215 CGCTCCCTCGCTAGGCTCTGAGG - Intergenic
925684796 2:6459336-6459358 CACTCCCCACCGGGGCTCTCGGG - Intergenic
928138472 2:28706952-28706974 CACTCCCCCCAGAGGCTCTGGGG - Intergenic
929004421 2:37381558-37381580 CTCTCCCACTCTAGGTTCCCAGG - Intergenic
931364751 2:61609391-61609413 CCCTCCCACCTTAGCCTCTCAGG - Intergenic
931435635 2:62243742-62243764 AACTCCCACCCTGTGCTCTGGGG + Intergenic
932263437 2:70345905-70345927 CACTCCCTCCCTTGCCCCTCAGG + Intergenic
932571915 2:72942673-72942695 CACCCTCACCCTAGGCTATCTGG + Exonic
932580524 2:72990187-72990209 CATGCCCACCCTGGGCTCTCGGG + Intronic
934777103 2:96946512-96946534 CAATCCCAGGCTGGGCTCTCAGG + Intronic
935839374 2:107092499-107092521 TCCTCCCACCTCAGGCTCTCTGG + Intergenic
937072534 2:119074908-119074930 CACGCCCTCCCTTGCCTCTCTGG - Intergenic
937092145 2:119213545-119213567 CACTCCCATCTTAGTCCCTCCGG - Intergenic
937166591 2:119824421-119824443 CCCTCCCACCTCAGGCTCCCAGG + Intronic
937493998 2:122398846-122398868 CACTGGCTCCCCAGGCTCTCAGG + Intergenic
937927899 2:127182064-127182086 CACTCCCACCCTAGGCTCTCAGG - Intergenic
942398432 2:175576453-175576475 GCCTCCCACCCCAGGCTCTGGGG + Intergenic
942713864 2:178868880-178868902 AACTCCAACCCTTGACTCTCAGG - Intronic
944471152 2:200055094-200055116 CACTCGCAGCCTGGGCTCTCGGG + Intergenic
944531020 2:200667905-200667927 CACTAGCACCCTGGGGTCTCTGG + Intronic
946449841 2:219770484-219770506 TCCTCCCACCTTAGCCTCTCAGG + Intergenic
946844841 2:223850271-223850293 CCCTCCCATCATAGGCCCTCAGG + Intergenic
947758766 2:232588207-232588229 GCCTCCCACCCCATGCTCTCTGG + Intergenic
1169068805 20:2709362-2709384 CATCCCCAGGCTAGGCTCTCAGG + Intronic
1172113751 20:32562114-32562136 CATTCTCACCCTAAGCACTCAGG + Intronic
1172260188 20:33557612-33557634 TACTCCCACCTCAGCCTCTCAGG + Intronic
1173628115 20:44488841-44488863 CACTCCCACCTCAGACTCTGAGG - Intronic
1174175660 20:48643049-48643071 CCCCCCCACCCTTGGTTCTCAGG - Intronic
1175630770 20:60534629-60534651 CACTCCTACCAGAGGCTCTAAGG - Intergenic
1175699684 20:61127906-61127928 CGCTCCCTCCGTAGGCTCTAGGG - Intergenic
1176061301 20:63174093-63174115 CACTCCCACCCTCAGCGCTCAGG + Intergenic
1176520153 21:7818253-7818275 CACTCCTTCCCCTGGCTCTCGGG + Exonic
1176785921 21:13255720-13255742 TACCCCCACCCTAAGCTCTCTGG + Intergenic
1177254614 21:18644978-18645000 CACTCCCACTGGAGGCTCTAGGG + Intergenic
1177821602 21:26036255-26036277 CACCCCCACCCTAGCCTTTGTGG - Intronic
1178587707 21:33884005-33884027 TCCTCCCACCCTAGCCTCCCAGG + Intronic
1178654179 21:34448265-34448287 CACTCCTTCCCCTGGCTCTCGGG + Intergenic
1179713271 21:43275017-43275039 CACTCCCTGCCTGGGCTGTCAGG + Intergenic
1180097554 21:45564904-45564926 CACTGCCACCCTGACCTCTCGGG - Intergenic
1180602936 22:17034415-17034437 CACACACACCCTAGGCTTCCGGG - Intergenic
1181061978 22:20285966-20285988 ACCTCCCAGCCTAGGCTCTGAGG - Intergenic
1181380128 22:22495765-22495787 TACTCCCCTCCTAGACTCTCAGG + Intronic
1181420309 22:22793037-22793059 AAAACCCACCCTGGGCTCTCAGG + Intronic
1182103596 22:27673826-27673848 CACACCCAGCCTAGGCACCCAGG + Intergenic
1182582891 22:31325715-31325737 CACTCCCACCCCAGGTGCTGGGG + Intergenic
1182721531 22:32405043-32405065 CACCCCCACCCCAGGGTCTCTGG - Intronic
1182808896 22:33099126-33099148 CTCTACCCTCCTAGGCTCTCTGG - Intergenic
1182941817 22:34284095-34284117 CATTCCCACACTAGGCCCTGGGG + Intergenic
1183195037 22:36347625-36347647 TCCTCCCACCTTAGCCTCTCTGG - Intronic
1183253081 22:36744028-36744050 TACTCCCACCTCAGGGTCTCTGG + Intergenic
1184429005 22:44430328-44430350 CACTCCCTGCCCAGGCTCACAGG + Intergenic
1184465985 22:44669049-44669071 CTCTCCCACCCCAGCCTCCCGGG + Intronic
1184472803 22:44705188-44705210 CGCTCCCACCAGAGGCTCTAGGG + Intronic
1184734260 22:46388827-46388849 CACTCCCACCCGCAGCTCTGAGG - Intronic
949980616 3:9499968-9499990 CTCCCCCACCCCAAGCTCTCGGG + Exonic
950510855 3:13425680-13425702 CACCCCGACCCTGGGCTCTCAGG + Intergenic
950634256 3:14303834-14303856 CACCCCCACCCTGTGCTCTGGGG - Intergenic
951251597 3:20400399-20400421 CTCTGACACCCTAGGCCCTCAGG + Intergenic
951534857 3:23731259-23731281 CACTCCCTCCAAAGGCTCTAAGG + Intergenic
953120821 3:40039871-40039893 CACTCCCTCCCAAGTCTCTTGGG + Intronic
953407866 3:42668529-42668551 CACTGTCATCCTAGGCTCTGGGG + Intergenic
953471637 3:43172131-43172153 CACTCCAACCTTCGCCTCTCGGG - Intergenic
953477744 3:43220450-43220472 CACTGCTACCCTAGTCTATCAGG + Intergenic
954628213 3:52034498-52034520 CCCTCCCTCTCTAGGCCCTCGGG - Intergenic
957734449 3:84188324-84188346 CTCTCCCACTCTAGGATCCCAGG - Intergenic
958420798 3:93928221-93928243 CACTCCCGCCTTAGCCTCCCAGG - Intronic
959583141 3:108002340-108002362 CATTCCCTCCAGAGGCTCTCGGG + Intergenic
960758699 3:121049069-121049091 CACCCCCTACCTAGGCTCTCAGG - Intronic
961076444 3:123987099-123987121 CACTCCCACACCAAACTCTCTGG + Intronic
961861031 3:129916867-129916889 CTCTCCCACCCCAGCCTCTCAGG - Intergenic
961915400 3:130368953-130368975 CACTCCCACCTGAGGATCTGAGG - Intronic
962609874 3:137066220-137066242 CATTGCCAGCCTCGGCTCTCAGG + Intergenic
964007731 3:151851908-151851930 CACCCCTACCCTAGGTGCTCAGG + Intergenic
964426682 3:156561568-156561590 CCCTCCCATCATAGGCTCTGAGG + Intergenic
965335891 3:167430618-167430640 CACTCCCACTGTAGGTTCCCAGG + Intergenic
965951065 3:174308792-174308814 CACTACCACCCTGGGGTTTCAGG + Intergenic
968464160 4:742155-742177 CTCTCTCTCCCCAGGCTCTCGGG + Intronic
968717376 4:2170586-2170608 CAGACCCACCCGAGACTCTCAGG - Intronic
969179143 4:5424003-5424025 CACTCCCCCCGTAGGCTCAGGGG + Intronic
969505539 4:7584885-7584907 GACTCCCATGCTAGGCTCTGGGG + Intronic
969951531 4:10841443-10841465 CACTCCCACCTTTGCCTCTCAGG - Intergenic
970017629 4:11530615-11530637 CACTCCCTCCGGAGGCTCTAGGG + Intergenic
972237404 4:37150278-37150300 CACTGCCACCCTAGGCCATGAGG + Intergenic
972954279 4:44369687-44369709 CTCTCCCACCTCAGCCTCTCAGG - Intronic
973369959 4:49236805-49236827 CACTCACACCAAAGGCCCTCTGG + Intergenic
974684929 4:65215475-65215497 CACTCTCAACCCAGGCTCTGTGG + Intergenic
974853085 4:67427291-67427313 CACTCCCACTAACGGCTCTCGGG + Intergenic
982516381 4:156355569-156355591 CACTTCCACCCTCCCCTCTCTGG + Intergenic
985994135 5:3587279-3587301 CACTCCCAGCCAAGGCACACAGG + Intergenic
987074495 5:14368041-14368063 CACACCCTCCCTTGGCTCTACGG + Intronic
988347537 5:30057597-30057619 CTCTCCCACCTTAGCCTCCCAGG + Intergenic
988484115 5:31654275-31654297 CACTCCTTACCTTGGCTCTCTGG + Intronic
988654266 5:33190645-33190667 CACCACCACCCTAGTCTCCCAGG + Intergenic
990781050 5:59363807-59363829 CAGTCCCACCCCAGGCTCACAGG - Intronic
992036381 5:72782620-72782642 CACTCCCATCATAGGCTCAAGGG + Intergenic
993382062 5:87219395-87219417 CATTCACACTCTATGCTCTCAGG + Intergenic
996234258 5:121107459-121107481 CACTCCCTCCATGGGCTCCCTGG + Intergenic
997517307 5:134499564-134499586 CACTCCCACCTCAGCCTCCCAGG - Intergenic
997606237 5:135177462-135177484 CTCTCTCACCTGAGGCTCTCAGG - Intronic
997639183 5:135437425-135437447 CCCCCACACCCAAGGCTCTCAGG + Intergenic
997985975 5:138501901-138501923 CATGCCCAGCCTAGGCTCTCTGG - Intergenic
999152232 5:149433890-149433912 CACTCCCTCCCTGGGCTCCTTGG - Intergenic
999610361 5:153362548-153362570 CACTCCCTTCCTAGGGACTCAGG - Intergenic
1000607480 5:163340063-163340085 CTCTCCCACTCTAGGTTCCCAGG + Intergenic
1000827180 5:166059487-166059509 CCCTCCCACCTCAGCCTCTCAGG + Intergenic
1001590415 5:172860873-172860895 CAGTCCCAGCCTAGGTTCTCAGG - Intronic
1002046605 5:176544902-176544924 CACTCTCAGCCCAGACTCTCCGG + Intronic
1004731830 6:18366485-18366507 CACCATCCCCCTAGGCTCTCAGG - Intergenic
1005854565 6:29851223-29851245 CCCTCCCTGCCTAGGCTCACAGG - Intergenic
1006793519 6:36718262-36718284 CACTCCCCACCTCGTCTCTCTGG - Intronic
1007413856 6:41680634-41680656 CACTCCAACTCTAGCCTCCCAGG + Intergenic
1008105182 6:47433458-47433480 TCCTCCCACCTTAGCCTCTCAGG + Intergenic
1008564060 6:52750003-52750025 CAGACCCACCCTCTGCTCTCAGG - Intergenic
1008565574 6:52764719-52764741 CAGACCCACCCTCTGCTCTCAGG - Intergenic
1008568373 6:52791284-52791306 CAGACCCACCCTCTGCTCTCAGG - Intergenic
1008569759 6:52805057-52805079 CAGACCCACCCTCTGCTCTCAGG - Intergenic
1008572825 6:52831277-52831299 CAGACCCACCCTCTGCTCTCAGG - Intergenic
1008579772 6:52896243-52896265 CAGACCCACCCTCTGCTCTCAGG - Intronic
1008741488 6:54614708-54614730 CACTGCCTCCCTTGGCTGTCGGG - Intergenic
1010022550 6:71177517-71177539 CATTTCCATCCTGGGCTCTCAGG + Intergenic
1011163408 6:84418746-84418768 CACTCCCTCCAGAGGCTCTCAGG + Intergenic
1015204582 6:130620584-130620606 CACGCCCAGCCTAGGGTCACTGG + Intergenic
1015841767 6:137484752-137484774 CACTCCCACCCTCCCCTCACTGG - Intergenic
1016768296 6:147819756-147819778 CAATCCCTGCCTCGGCTCTCAGG - Intergenic
1016868992 6:148798259-148798281 CACTCCTCCCCTTGGCTCTGAGG - Intronic
1018395493 6:163375175-163375197 CACTCCCACACAAGGCGCTCTGG - Intergenic
1018830587 6:167439858-167439880 CACTCCCTCCAAAGGCTCTGGGG - Intergenic
1019135570 6:169905617-169905639 CACTCACACCCTGGGTTCCCAGG - Intergenic
1020523756 7:9230257-9230279 CACTCCAAACCCAGGCTCACTGG - Intergenic
1021422688 7:20463616-20463638 CCCTCCCTCCCTATCCTCTCTGG + Intergenic
1021903012 7:25306322-25306344 CCCTCCAACCCTAGGCTGCCTGG + Intergenic
1022957225 7:35392164-35392186 CATTCCCACCCAGGGCTCACGGG + Intergenic
1025166802 7:56719686-56719708 CCCTCCCACCCTAGCCTCCCAGG - Intergenic
1028961527 7:96754442-96754464 TACCCCCACCCCAGGCTCTCAGG + Intergenic
1031012455 7:116538007-116538029 CAGCCCCACCCCAGGGTCTCTGG - Intronic
1032544567 7:132730896-132730918 TCCTCCCACCCTAGCCTCCCAGG - Intergenic
1033498943 7:141928187-141928209 CACTCCCACCCCAGGCCATTGGG + Exonic
1033563760 7:142558989-142559011 CATTCCTTCCCGAGGCTCTCAGG + Intergenic
1034230448 7:149522429-149522451 CACTCCCACCATAGTCCCTAGGG + Intergenic
1034529247 7:151685133-151685155 CACTCCCACCCTGGGCTGGGGGG - Intronic
1034996147 7:155578327-155578349 CTCTCACACTCCAGGCTCTCTGG + Intergenic
1036759711 8:11499270-11499292 TACTCCACCCCTAGGCTCTGTGG - Intronic
1037847626 8:22297805-22297827 GCCTCCAACCATAGGCTCTCAGG + Intronic
1037947139 8:22996684-22996706 CCCTCCCACCCCAGGCCCTGAGG - Intronic
1039478131 8:37852131-37852153 CAAGCCCACCCTGGGCACTCGGG - Intergenic
1041211817 8:55559582-55559604 CACTCCTCCCCTAGGGGCTCAGG + Intergenic
1042612639 8:70615229-70615251 CATTCCACCCCTAGGCTCTGTGG + Intronic
1042976815 8:74478702-74478724 CACTCCCACACCAGACCCTCTGG + Intronic
1045909635 8:107391589-107391611 CACTCCAACCTCAGCCTCTCGGG - Intronic
1048021369 8:130542277-130542299 CACTCCCATCTTATACTCTCAGG - Intergenic
1050547954 9:6724964-6724986 CACTCCCTCCAGAGGCTCTGGGG + Intronic
1051376863 9:16410736-16410758 CAATCCCACCCTTTGCTCTTCGG - Exonic
1053307093 9:36992429-36992451 CACTCACTCCCCAGGCTCTCGGG + Intronic
1054888404 9:70224467-70224489 CAGTGGCACCCTAGGTTCTCAGG - Intronic
1055306507 9:74934919-74934941 CATTCCCACCCTAAGCTTTCTGG - Intergenic
1055331400 9:75187688-75187710 CACTCCCTCCCAAGGCTCCCCGG - Intergenic
1056131169 9:83588079-83588101 CATCCCCACCCTAGCCTTTCAGG + Intergenic
1056778586 9:89532621-89532643 CATTGCCACCGTCGGCTCTCTGG + Intergenic
1056815967 9:89801111-89801133 CACCCCCACCCTACACTCTGTGG - Intergenic
1056996165 9:91461543-91461565 CACTCCCTCCGGAGGCTCTTGGG + Intergenic
1057243042 9:93429353-93429375 TCCTCCCACCTTAGCCTCTCAGG - Intergenic
1057304102 9:93902576-93902598 CCCTCCCACCTTGGGCTCTGGGG - Intergenic
1057967455 9:99517967-99517989 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1058767850 9:108199076-108199098 CACTGCCACCCGAGGCTGTGAGG - Intergenic
1059182586 9:112231798-112231820 TCCTCCCACCTCAGGCTCTCAGG - Intronic
1059890339 9:118795092-118795114 CTCTCCCACCCTCCACTCTCAGG + Intergenic
1060282628 9:122224587-122224609 CACTCCCACCCTCTCCTCTGAGG - Intronic
1061125293 9:128671189-128671211 CCCTCCCACCTCAGCCTCTCTGG - Intergenic
1061190315 9:129078978-129079000 CACTCCCAGCCTGGGCTCGTCGG - Intergenic
1062213171 9:135375427-135375449 CCCTCCCACCGAAGGCTCTGCGG - Intergenic
1062599492 9:137313495-137313517 CACTCCCACCCCACCTTCTCAGG - Intronic
1062713385 9:137988915-137988937 GGCTCCCACCCTGGGATCTCAGG - Intronic
1062715486 9:138008108-138008130 CACTGCCCCCTCAGGCTCTCTGG - Intronic
1185609858 X:1387766-1387788 CACCCCCACCCCAGGACCTCAGG + Intronic
1185760210 X:2684721-2684743 CCCTCCCACCCTTGGTTCTGTGG - Intergenic
1186192866 X:7083082-7083104 CACTCCCTCTGTAGGCTCTAGGG - Intronic
1186193356 X:7087369-7087391 CACTCCCTCTCAAGGCTCTAGGG - Intronic
1188068831 X:25695011-25695033 CACCACCACCCTAGGCCCTAAGG + Intergenic
1188524187 X:31071667-31071689 CTCTCCCAGCCTTGGCACTCTGG + Exonic
1189010668 X:37043288-37043310 CTCTCCCAGCCTTGGCCCTCTGG + Intergenic
1189035735 X:37492267-37492289 CTCTCCCAGCCTTGGCCCTCTGG - Intronic
1189037220 X:37505580-37505602 CTCTCCCAGCCTTGGCACTCTGG - Intronic
1189310367 X:40013836-40013858 CACCCCCACCCTAACCACTCCGG - Intergenic
1190126713 X:47712032-47712054 CACTGCCACCTCAGTCTCTCAGG + Intergenic
1190389083 X:49913753-49913775 CACTCCCACCTTAGGAGATCAGG + Intergenic
1191717000 X:64200603-64200625 CACTCCTCCCCCAGCCTCTCAGG - Intronic
1192236142 X:69297375-69297397 CCCTCCCCCCGTAGGCTCTGTGG + Intergenic
1192342819 X:70278162-70278184 CACCCCACCCCTTGGCTCTCTGG - Intronic
1192667300 X:73101483-73101505 CACTACCACCCCAGGCCCTGAGG + Intergenic
1193425628 X:81337897-81337919 CACACCCTGCCTGGGCTCTCGGG - Intergenic
1195815113 X:108876685-108876707 CACTCCCAGCCCAGGATGTCTGG - Intergenic
1196245265 X:113392121-113392143 CACTCCTCTCCTAGGTTCTCAGG - Intergenic
1198190526 X:134299808-134299830 CACCACCACCCTAGGCTGTGAGG - Intergenic
1199245488 X:145599233-145599255 CACCCCCAACCTGGGCTCTCAGG + Intergenic
1200041660 X:153375312-153375334 CACTCCCCCCAGAGGCTCTAGGG - Intergenic
1200375001 X:155770482-155770504 CACTCCCATCACAGTCTCTCTGG - Intronic
1201263151 Y:12179899-12179921 CACTGCCACCCTCGCCTCTCAGG - Intergenic
1201565288 Y:15358877-15358899 CACTCCCTCTCAAGGCTCTAGGG - Intergenic