ID: 937931084

View in Genome Browser
Species Human (GRCh38)
Location 2:127205658-127205680
Sequence GAGGGGCGACGCTGGCTCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937931084_937931096 12 Left 937931084 2:127205658-127205680 CCACGGAGCCAGCGTCGCCCCTC 0: 1
1: 0
2: 1
3: 6
4: 126
Right 937931096 2:127205693-127205715 GGGACAACTCTGCACGGAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 78
937931084_937931095 9 Left 937931084 2:127205658-127205680 CCACGGAGCCAGCGTCGCCCCTC 0: 1
1: 0
2: 1
3: 6
4: 126
Right 937931095 2:127205690-127205712 GACGGGACAACTCTGCACGGAGG 0: 1
1: 0
2: 0
3: 2
4: 30
937931084_937931087 -9 Left 937931084 2:127205658-127205680 CCACGGAGCCAGCGTCGCCCCTC 0: 1
1: 0
2: 1
3: 6
4: 126
Right 937931087 2:127205672-127205694 TCGCCCCTCCTGGCTCCTGACGG 0: 1
1: 0
2: 3
3: 27
4: 277
937931084_937931094 6 Left 937931084 2:127205658-127205680 CCACGGAGCCAGCGTCGCCCCTC 0: 1
1: 0
2: 1
3: 6
4: 126
Right 937931094 2:127205687-127205709 CCTGACGGGACAACTCTGCACGG 0: 1
1: 0
2: 0
3: 10
4: 69
937931084_937931088 -8 Left 937931084 2:127205658-127205680 CCACGGAGCCAGCGTCGCCCCTC 0: 1
1: 0
2: 1
3: 6
4: 126
Right 937931088 2:127205673-127205695 CGCCCCTCCTGGCTCCTGACGGG 0: 1
1: 0
2: 1
3: 20
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937931084 Original CRISPR GAGGGGCGACGCTGGCTCCG TGG (reversed) Exonic
900296791 1:1955952-1955974 GAGGGGCCACGCTGGAGCCAGGG - Intronic
903115699 1:21176773-21176795 GAAGGGCGCCGCTTCCTCCGGGG - Exonic
903682662 1:25107409-25107431 GAGGAGCGAAGATGGCTGCGTGG - Intergenic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
908401285 1:63774596-63774618 GAAGCGCCGCGCTGGCTCCGGGG + Intronic
908780544 1:67685960-67685982 GGGGGGCGGCGATGGCCCCGAGG + Intronic
912542397 1:110427013-110427035 GAAGGGCCACGCTGCCTCTGGGG - Intergenic
912700523 1:111875065-111875087 GAGGGGCCATGGTGGCTCCAGGG + Intronic
912993273 1:114510310-114510332 GGGAGGGGACACTGGCTCCGAGG - Intronic
916683715 1:167126388-167126410 GGAGAGCGACGCTGGCTCCTCGG + Exonic
916717253 1:167455940-167455962 GAGGGCCGGCGCTGCCTCCTTGG + Intronic
916890247 1:169106583-169106605 GAGGGACGGCGCAGGCTGCGCGG - Exonic
919765122 1:201122189-201122211 GAGGGGCTAAGCAGGCTCTGGGG - Intronic
920511787 1:206557240-206557262 GAGGGAGGGCGCTGGCGCCGGGG + Intronic
920966497 1:210705524-210705546 GAGGGTCGACCCTGGCCCAGAGG + Intronic
922798487 1:228353205-228353227 GAGGGGCTGGGCTGGCACCGTGG + Intronic
924112134 1:240710718-240710740 GGTTGACGACGCTGGCTCCGCGG + Intergenic
1062939593 10:1411280-1411302 GCGGGGCAACCCTGGCTTCGGGG + Intronic
1064560824 10:16594053-16594075 GCGCAGCGAAGCTGGCTCCGTGG + Intronic
1069592379 10:69650136-69650158 GAGGGGTGAGGGTGGCTCAGTGG + Intergenic
1069807798 10:71136848-71136870 CAGGGGCCACGCTGACTCTGAGG - Intergenic
1074618246 10:115092628-115092650 GAGGCGCGAGGCGGTCTCCGCGG - Intergenic
1075802050 10:125160095-125160117 GGGGGTGGACGCTGGCTCGGGGG - Intronic
1076785970 10:132750115-132750137 GAGGGGAGACGCTGGTGCTGTGG + Intronic
1077076872 11:706037-706059 GCGGGGCGGAGCTGGGTCCGAGG + Intronic
1083267868 11:61555287-61555309 GGGGGGCGACGGTGGGCCCGGGG - Intronic
1091915343 12:4269228-4269250 GGGTCGCGGCGCTGGCTCCGGGG + Intergenic
1092261055 12:6953534-6953556 CAGGGGTGACACTGGCTCCTGGG - Intronic
1098255417 12:68611001-68611023 GCGGGGCGACGCTGGCTGCAGGG + Exonic
1103120670 12:118376908-118376930 GAGGGGCGGGGCGGCCTCCGGGG + Intronic
1105011762 12:132761393-132761415 GAGGGGCCACGCCGGGTTCGGGG - Intronic
1112292545 13:98157497-98157519 GAGGGTCCACGCTGGCACCCGGG - Intronic
1113542016 13:111115910-111115932 GAGGGGCGGCGCGGGCGGCGGGG + Intronic
1113800645 13:113084713-113084735 GAGGGCCGGCACTGGCTCCCAGG - Intronic
1117383840 14:55191832-55191854 GAGGGGTGAGGCTGGGTCCCTGG + Intergenic
1118210532 14:63761944-63761966 ACGGGGTGACGCTGGCTGCGGGG + Intergenic
1121050388 14:90816122-90816144 GGGGGGCGCCGCGGCCTCCGCGG - Intronic
1130032917 15:80332329-80332351 GAAGGGTGAGGGTGGCTCCGTGG + Intergenic
1130085978 15:80779019-80779041 CACGGGCGACCCTGGCTCCTTGG + Intergenic
1130152783 15:81324142-81324164 GAGCGGCGGCGCTGGATCCCGGG + Intronic
1130871223 15:87973804-87973826 GAGGGGCGATGCTGGCTGCTTGG - Intronic
1130932250 15:88437880-88437902 GAGGAGCTAGGCTGGCTCCGGGG + Intergenic
1140772876 16:78222206-78222228 GAGGGGCTAAGCTGTCTCCTGGG + Intronic
1141701630 16:85645061-85645083 GAGGGGAAACGCTGGCTGCAGGG - Intronic
1141943403 16:87293721-87293743 GAGGGGTGACACTGGCTCGCTGG - Intronic
1141955913 16:87371201-87371223 CAGGAGCTACGCTGGCTCAGTGG - Intronic
1142379022 16:89721429-89721451 GAGCGGGGGCGCTGGCACCGCGG + Intronic
1142474395 17:180817-180839 GGGGCGCGGCGCCGGCTCCGAGG + Intronic
1143078483 17:4365448-4365470 GAGGGGGGCCGCAGGCTCCTCGG + Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1144998231 17:19285688-19285710 AAGGGGTGGCGCTGGCTCAGTGG - Exonic
1147285721 17:39401506-39401528 GAGGGGTGACGCCGGGACCGTGG + Exonic
1148196862 17:45720252-45720274 TAGGGGCGATGCTGGCACTGCGG + Intergenic
1148698695 17:49575886-49575908 GAGCGGCGCCGCTGGAGCCGAGG + Exonic
1148790367 17:50169257-50169279 GAGGAGGGACCCTGGGTCCGGGG + Intronic
1152488562 17:80613021-80613043 AAGGGGGGACCCTGGCTCTGTGG - Intronic
1152781560 17:82229287-82229309 GAGGGGCGCGGCTGGCTCTCGGG - Intronic
1152924533 17:83081017-83081039 GGGGGGCGACTGTGGCTTCGCGG - Intronic
1154279682 18:12991440-12991462 GAGGGGGGACGCTGGTGCCTCGG + Intronic
1160242301 18:77132607-77132629 GAGGGGCGCCGCGGGGTCCAAGG + Exonic
1161409775 19:4110667-4110689 GAGGGGCGAGACTGGCTTGGGGG + Intronic
1161739590 19:6012572-6012594 GGGGGGTGATGCTGGCTCCGCGG + Intronic
1161853798 19:6752787-6752809 GAGGGGCGAGGCGGGCGCCTGGG - Intronic
1162106154 19:8371078-8371100 GAGGCGCCACGATGGCTCAGTGG + Exonic
1162790231 19:13058959-13058981 AAGGTGAGACGGTGGCTCCGGGG - Intronic
1166296563 19:41892863-41892885 GAGGGGCGACGCTCCCACCAGGG - Intronic
925714234 2:6770253-6770275 GAGGGGAGACGCAGGCTCCTGGG + Intergenic
927215773 2:20667198-20667220 GGCGGGCGGCGCGGGCTCCGTGG - Exonic
927940432 2:27099959-27099981 GAGAGGAGAAGCTGGCTCTGAGG - Exonic
934662924 2:96152779-96152801 GAGGGGCGGGGGTGGCTCCCAGG + Intergenic
935396879 2:102619259-102619281 GACGTCCGACGCTGCCTCCGGGG + Intergenic
936072881 2:109383082-109383104 GAGGGCGGGCCCTGGCTCCGAGG + Intronic
937931084 2:127205658-127205680 GAGGGGCGACGCTGGCTCCGTGG - Exonic
947751612 2:232535549-232535571 GAGGCCCGAGGCTGGCTCAGGGG + Exonic
948874696 2:240820348-240820370 GACGGGCGACGCGGCCGCCGCGG + Intergenic
948988738 2:241541333-241541355 GAGGGGTGGGGCTGCCTCCGAGG + Intergenic
1172931129 20:38587192-38587214 GAGGCGAGAGGCTGGCTCCCGGG - Intronic
1173079175 20:39849796-39849818 GAGGGGCGTTGCTGGCTCCCTGG - Intergenic
1174088397 20:48026957-48026979 GAGGGCTGACTCTGGCTCAGAGG - Intergenic
1176152495 20:63599190-63599212 GAGCGGCCACGTTAGCTCCGGGG - Intronic
1178544176 21:33479644-33479666 AAGGGGCGGCGGGGGCTCCGCGG + Intronic
1178906889 21:36643957-36643979 GAGGGGCGGCTGTGCCTCCGTGG - Intergenic
1179799160 21:43802864-43802886 CAGGGGCAACCCTGGGTCCGCGG + Intronic
1181024037 22:20117596-20117618 GTCGGTCGTCGCTGGCTCCGCGG - Exonic
1182296254 22:29312399-29312421 GAGGGGCGGCGGGGGCCCCGAGG - Exonic
1183513197 22:38247914-38247936 CGTGGGCGACGCTGGATCCGGGG + Exonic
1183599534 22:38831962-38831984 GAGAGGAGATGCTGGCTCCAGGG - Intronic
1183749893 22:39713940-39713962 CAGGGCCGAGGCTGGCTCTGGGG + Intergenic
1184711289 22:46250772-46250794 GAGGGGCGCCGCAGGCGACGTGG - Intergenic
952990775 3:38829119-38829141 GAGGGGCAATGGTGGCTCCCAGG + Intergenic
953620112 3:44525840-44525862 GAGGGGCCAGGCTGGAGCCGTGG - Intergenic
953768005 3:45758983-45759005 GAGGGGAGACGCAGACCCCGTGG - Exonic
954110336 3:48429716-48429738 GCGGGGCGGCTCTGGCTCCCGGG - Intronic
954327147 3:49869802-49869824 GCGGGGCGCCGAGGGCTCCGGGG + Exonic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
956818309 3:72929006-72929028 GAGAGGCGGCGGTGGCTGCGCGG - Intronic
962259720 3:133895101-133895123 GAGGGCGGCGGCTGGCTCCGCGG - Intronic
968455990 4:700024-700046 GAGGGGCGAGGCTGGGTGGGGGG + Intergenic
968481803 4:836460-836482 GAGCGGCGACGGTGGCTGCATGG + Intergenic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
985668405 5:1193626-1193648 GAGGGGAGATGCTGCCTCCTGGG - Intergenic
987713413 5:21533904-21533926 GAGGAGCTACGGTGGCTCCAGGG - Intergenic
990943868 5:61230141-61230163 GAGGGGAGAGGGTGGCTCCTGGG - Intergenic
994359985 5:98839644-98839666 GCCGCGCGCCGCTGGCTCCGGGG - Intergenic
995047732 5:107670363-107670385 CCCGGGCGACGCAGGCTCCGAGG + Intronic
1002897699 6:1389187-1389209 GAGGGGCGGGGCTGGGTCCTGGG + Intergenic
1006043223 6:31271717-31271739 GAGGGGAGCCGCGGGCGCCGTGG - Exonic
1006193496 6:32223366-32223388 GAGGGGCGGAGGTGGCTCCCGGG + Intronic
1009003302 6:57747992-57748014 GAGGAGCTACGGTGGCTCCAGGG + Intergenic
1011016968 6:82767615-82767637 GAGGGCCGAGGCTGGCTTCAGGG - Intergenic
1014913671 6:127120339-127120361 CAGGGGCGACCCTGGCTCTATGG + Intronic
1019278657 7:188995-189017 GAGGGACGACGCTGGGTCTTGGG - Intergenic
1019312154 7:368135-368157 GTGGGGGGACGCTGGGTCGGGGG - Intergenic
1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG + Intergenic
1026017333 7:66681839-66681861 GGAGGGCGACGCCGGCACCGCGG - Intronic
1026025373 7:66740408-66740430 GGAGGGCGACGCTGGCTCCGCGG - Intronic
1033547240 7:142412802-142412824 GAGGGGCGAAGATGGCTCTCTGG + Intergenic
1035308905 7:157952496-157952518 GGAGGGAGACGCTGACTCCGTGG + Intronic
1035923236 8:3700982-3701004 GAGGGGCGACGGTGGTTTGGGGG + Intronic
1037381349 8:18288272-18288294 GAGGAGAGACCCTGGCTCAGTGG - Intergenic
1041200879 8:55451325-55451347 GAGTGGTGACCCTGGCTCTGGGG + Intronic
1049283644 8:141763050-141763072 GAGGGGCGAGGCTCACACCGAGG + Intergenic
1049373498 8:142278622-142278644 CAAGGGTGACGCTGGCTCTGAGG - Intronic
1049392487 8:142379415-142379437 GAGGGGCTACGCTTGCCCAGAGG + Intronic
1049615024 8:143572322-143572344 GGGGGGCGGTGCTGGCCCCGGGG - Intronic
1056768534 9:89460202-89460224 GAGGGGCTGCACTGGCTCTGTGG - Intronic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1059335307 9:113565178-113565200 GAGGGGCCCAGCTGGCTCCCGGG - Intronic
1060629455 9:125143140-125143162 GAGGGGTGAGGCTGGCGGCGCGG - Intronic
1060921291 9:127422389-127422411 GAGGGGTGACACTTGCTCCTGGG + Intergenic
1062193112 9:135257721-135257743 GAGGGGCCACGCTGGACCCAGGG - Intergenic
1062544220 9:137054362-137054384 GGCGGGCGAGGCTGGCTCGGAGG + Intergenic
1189321507 X:40090271-40090293 GAGGGGAGACGGCGGCGCCGGGG + Intronic