ID: 937931150

View in Genome Browser
Species Human (GRCh38)
Location 2:127205941-127205963
Sequence CTCCCGCCAGGACTCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 121}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937931143_937931150 6 Left 937931143 2:127205912-127205934 CCGGTGGCTCTCCCCCGCAAGTC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG 0: 1
1: 1
2: 0
3: 8
4: 121
937931146_937931150 -6 Left 937931146 2:127205924-127205946 CCCCGCAAGTCTCGGTACTCCCG 0: 1
1: 0
2: 0
3: 4
4: 24
Right 937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG 0: 1
1: 1
2: 0
3: 8
4: 121
937931138_937931150 30 Left 937931138 2:127205888-127205910 CCACATACTCACGCCGAGATGAG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG 0: 1
1: 1
2: 0
3: 8
4: 121
937931145_937931150 -5 Left 937931145 2:127205923-127205945 CCCCCGCAAGTCTCGGTACTCCC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG 0: 1
1: 1
2: 0
3: 8
4: 121
937931147_937931150 -7 Left 937931147 2:127205925-127205947 CCCGCAAGTCTCGGTACTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG 0: 1
1: 1
2: 0
3: 8
4: 121
937931148_937931150 -8 Left 937931148 2:127205926-127205948 CCGCAAGTCTCGGTACTCCCGCC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG 0: 1
1: 1
2: 0
3: 8
4: 121
937931142_937931150 7 Left 937931142 2:127205911-127205933 CCCGGTGGCTCTCCCCCGCAAGT 0: 1
1: 0
2: 0
3: 2
4: 92
Right 937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG 0: 1
1: 1
2: 0
3: 8
4: 121
937931141_937931150 17 Left 937931141 2:127205901-127205923 CCGAGATGAGCCCGGTGGCTCTC 0: 1
1: 0
2: 0
3: 18
4: 340
Right 937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG 0: 1
1: 1
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937931150 Original CRISPR CTCCCGCCAGGACTCCATGT TGG Intronic
902839844 1:19067830-19067852 GTCCAGCCAGGACTCCTTGTCGG + Intergenic
903010653 1:20327880-20327902 CTCCTGCCAGGATGCCATGTTGG + Exonic
905441226 1:37997547-37997569 CTCCCTCCAGGACTCGGTGGAGG - Exonic
905824992 1:41020595-41020617 CTCACCCCAGGACTCCATGAAGG + Exonic
906319272 1:44806503-44806525 CTCGCGCCGGGGCTCCATGCTGG - Exonic
912556959 1:110523529-110523551 CTCCCTCCAGGCCACCATGTGGG + Intergenic
916641050 1:166729462-166729484 CTCCAGGCAGCTCTCCATGTTGG - Intergenic
918119912 1:181529412-181529434 CCCCCGTAGGGACTCCATGTGGG - Intronic
920854001 1:209648937-209648959 CCCTAGCCAGGACTCCCTGTGGG - Intronic
921969766 1:221135403-221135425 TTCTCTCCAGGACTCCATTTTGG + Intergenic
924904369 1:248435653-248435675 CTCCCCCCAGGAATCGTTGTGGG + Intergenic
924923518 1:248656395-248656417 CTCCCCCCAGGAATCGTTGTGGG - Intergenic
1066611023 10:37248579-37248601 CTCTCATCAGGACTCCATGCAGG - Intronic
1068949118 10:62759899-62759921 TTCCAGCCAGGCCTCCCTGTTGG - Intergenic
1070635222 10:78120172-78120194 ATCCTGCCAGGACTGCCTGTTGG - Intergenic
1073323230 10:102628143-102628165 CTCCCGCCTGGCCTCCCTCTTGG - Intronic
1076147179 10:128132281-128132303 CTCCCGCCAGAGCTCCACCTGGG - Intergenic
1077504559 11:2924067-2924089 GACCCCCCAGGACTCCAGGTGGG - Intronic
1081994513 11:47355027-47355049 CTCCCTCCAGGACTCCACCCCGG - Exonic
1084065327 11:66700762-66700784 CTCCCCGCAGGGCTGCATGTTGG + Exonic
1084537350 11:69764846-69764868 CCTCCCCCAGGACCCCATGTAGG - Intergenic
1085340376 11:75727488-75727510 CGACTGCCAGGACTCCATGGGGG - Exonic
1090472942 11:126996257-126996279 CTCCTACCAGAACCCCATGTGGG - Intronic
1094753499 12:33439808-33439830 CTCCCCTCAGCACTCCATGCCGG - Exonic
1095728091 12:45474221-45474243 CCCCAGTGAGGACTCCATGTGGG - Intergenic
1095928787 12:47605738-47605760 CCCCAGCAGGGACTCCATGTGGG + Intergenic
1096072446 12:48782807-48782829 CTTCCGCCAGGACTCCATGTGGG - Exonic
1101966433 12:109285400-109285422 CTCCCGCAAGGGCTGCCTGTGGG - Exonic
1105323085 13:19346039-19346061 CACCCTCCAGGACTTCATCTTGG + Intergenic
1105874304 13:24539828-24539850 CACCCTCCAGGACTTCATCTAGG - Intergenic
1109091544 13:58052396-58052418 CTCCAGTAAGGACTCCGTGTGGG - Intergenic
1112225100 13:97531999-97532021 CTCCCTCCAGGCCTCCACTTGGG - Intergenic
1118318460 14:64739503-64739525 CTACAGCCTGGACCCCATGTTGG + Intronic
1121017927 14:90559595-90559617 CTCCCACCACGAGTCCATGTAGG - Intronic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1123825537 15:24078495-24078517 CTCCCGCCAAGCCTCCCTGATGG - Intergenic
1124370412 15:29101589-29101611 CTCCCGACAGGAAACCATGATGG + Exonic
1126286498 15:47018813-47018835 CTCCCTCCAAGTCTCCAGGTGGG - Intergenic
1128944601 15:71812015-71812037 CTCCGGCCGGGACTCAGTGTTGG - Exonic
1131034206 15:89210565-89210587 CTCTCCGCAGGTCTCCATGTTGG + Intronic
1135028419 16:19016557-19016579 CTCCCGCCACAGCTCCAGGTGGG - Exonic
1136392383 16:29973856-29973878 CTCCCGCCCGGTCTCCATCTTGG + Exonic
1138315687 16:56068125-56068147 CTATCACAAGGACTCCATGTAGG + Intergenic
1138763121 16:59567730-59567752 CCCCTGCCGGGACTCCCTGTGGG + Intergenic
1140917791 16:79509372-79509394 CTCCTCCCAGGACTGGATGTGGG - Intergenic
1141468488 16:84222580-84222602 CACCCGCCCGGACTCCTTCTCGG + Exonic
1142057477 16:88007383-88007405 CCCCCGCTAGGAGTCCAAGTAGG - Intronic
1142635375 17:1253915-1253937 GTCCCGCCGGGACTCCAGGAAGG - Intergenic
1145909506 17:28534420-28534442 CTCCCGCAAGGGCTGCCTGTGGG + Exonic
1147588596 17:41666957-41666979 CTCACTACAGGACTCCAGGTGGG + Intergenic
1149039582 17:52171898-52171920 CTCCCTCTAGCACTCCCTGTTGG + Intergenic
1149204522 17:54228212-54228234 CTCCAGTAGGGACTCCATGTGGG - Intergenic
1151816530 17:76474028-76474050 CTGCCACCAGGACCCCAGGTAGG - Exonic
1158443595 18:57499495-57499517 CTCCCCCCAGTACTCTGTGTTGG - Intergenic
1160707550 19:536552-536574 CTCCCACCAGGACCCCAGGCCGG + Intronic
1164837550 19:31367046-31367068 CTCCTGCCAGGGCTCCACATTGG + Intergenic
1167381687 19:49142093-49142115 CTCCAGCCAGGACACCACGGTGG - Exonic
1167690060 19:50979859-50979881 CTCCCCCCAGGACTGCACGAAGG - Exonic
1168061079 19:53892572-53892594 CTCCCGCAACGACTTCATGGGGG + Exonic
1168252760 19:55149735-55149757 CTGCCGCCAGGATTCCATCCTGG + Intergenic
925169451 2:1742106-1742128 ATCCAGCCAGGACTCCATTCTGG + Intronic
925284889 2:2709425-2709447 CTCCTTCCAGGGCTCCCTGTTGG - Intergenic
926136995 2:10343403-10343425 CTCCCTCCAGGACTCCCGGGTGG + Intronic
927483037 2:23469260-23469282 CACCCTCCAGGTCACCATGTGGG - Intronic
928174711 2:29025935-29025957 CTCCAGCCAGGACACTAGGTAGG + Intronic
928174904 2:29026994-29027016 CTCCAACCAGGACACCAGGTAGG + Exonic
929457195 2:42074431-42074453 CTCCTGCCAGGACCCCACATTGG + Intergenic
929993072 2:46805758-46805780 CTACCTCCAGGCCTTCATGTGGG + Intergenic
931456499 2:62413607-62413629 CCCCCGCTAGGACAGCATGTGGG + Intergenic
932442728 2:71748105-71748127 CAGCAGCCAGGACTCCATGGGGG - Intergenic
935059258 2:99593603-99593625 CTCCTGCTCGGACTCCAGGTCGG + Exonic
935687319 2:105695757-105695779 CTCCCGCCAGGCCTGGAGGTGGG - Intergenic
935987565 2:108689429-108689451 CTCCTGGCTGGACTCCATGCAGG - Intergenic
936126392 2:109792130-109792152 CTCCTGGCTGGACTCCATGCAGG - Intergenic
936218301 2:110579338-110579360 CTCCTGGCTGGACTCCATGCAGG + Intergenic
937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG + Intronic
945357634 2:208857920-208857942 CTCCCCACAGCACTTCATGTGGG + Intergenic
946400247 2:219464854-219464876 CTGCCGCCAGGGCTCCGTGATGG - Intronic
948045015 2:234936832-234936854 CGCTCCCCAGGACTTCATGTTGG - Intergenic
948868055 2:240785251-240785273 CTCCTGCCAGGACTCCAGCAGGG + Intronic
948900889 2:240956448-240956470 CTCCGCTCAGGACTCAATGTGGG - Intronic
1170475422 20:16709502-16709524 CGCTAGCCTGGACTCCATGTGGG + Intergenic
1170574429 20:17651942-17651964 CTCCTGCCAGGTCTCCCTCTGGG + Intronic
1172635244 20:36405812-36405834 CCCCAGCCTGGAGTCCATGTGGG - Intronic
1173014070 20:39209113-39209135 CTCACTCCAGAACTCCATGGAGG + Intergenic
1173183112 20:40819433-40819455 CTCCTGCCAGCACCCCATGCAGG - Intergenic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1174070760 20:47897521-47897543 CTCCCCCCAGGGCTCCAGCTCGG - Intergenic
1174153303 20:48501135-48501157 CTCCCCCCAGGGCTCCAGCTCGG + Intergenic
1180230790 21:46425730-46425752 CTGCCGCCAGGACTCTGTGAAGG - Intronic
1181394047 22:22605332-22605354 TTCCCTCCAGGTCTCCAGGTAGG + Intergenic
1184206151 22:43004836-43004858 CACCTGCCAGGACCCCATATGGG - Intronic
1185016897 22:48349494-48349516 CTCCCACCAGGACCCCCTTTTGG - Intergenic
950645693 3:14375310-14375332 CTCCTGCCAGGACGCCAAATAGG - Intergenic
950665154 3:14490779-14490801 CTTCCTCCAGGTCTCCATGGAGG + Exonic
951522121 3:23620052-23620074 CTGCCCCCAGGCCTCCATGCAGG + Intergenic
954149993 3:48652541-48652563 CTTCCTCCAGGACACCATGGCGG - Exonic
955790475 3:62583895-62583917 CGCCCTCCTGGACTTCATGTGGG + Intronic
960160942 3:114350240-114350262 CTGCTGCCAGGCCTCCAGGTGGG + Intronic
960945321 3:122962389-122962411 CACCCGCCGGGCCTGCATGTCGG - Intronic
962575504 3:136752087-136752109 CTCTCGCCCGGCCTCCATCTTGG + Intronic
966899086 3:184467486-184467508 CTGCCGTGTGGACTCCATGTGGG + Intronic
968693543 4:2008942-2008964 CTCCCGCATGGACGCCATCTTGG + Exonic
969394384 4:6910627-6910649 CTCCCGCCAGGAGTCTCTCTAGG + Intronic
973773648 4:54227411-54227433 CTCCCGCCCGGACTGCTTCTCGG + Intronic
974172277 4:58281702-58281724 CCCCAGTCAGGACTCCGTGTGGG - Intergenic
977115367 4:93017761-93017783 CTCCAGCCAGGACTCCAGCCAGG + Intronic
978079765 4:104577976-104577998 CTCTTGCCAGGACTCCTTATTGG + Intergenic
979808989 4:125012051-125012073 CTTCTGCCAGGACTCCCTATTGG - Intergenic
981172093 4:141636727-141636749 CTGCAGCCAGGACTCGATGGAGG + Exonic
993904858 5:93611684-93611706 CTCCCACCAGGACCCCATTCTGG - Intergenic
994813878 5:104558138-104558160 CTCCCACCAGGTCGACATGTGGG + Intergenic
996694471 5:126378706-126378728 CTCCCAACAGGAATGCATGTTGG + Intronic
1003227976 6:4223585-4223607 CTCCAGGAGGGACTCCATGTGGG - Intergenic
1006146402 6:31962356-31962378 CTTCCACGAGGGCTCCATGTGGG + Intronic
1019935941 7:4258038-4258060 CTCCCGCCAGGCCCCCTTCTTGG + Intronic
1020002284 7:4762732-4762754 CTCTCCCCAGGCCTCCCTGTCGG + Exonic
1022625515 7:32032205-32032227 TTCTCTCCAGGACCCCATGTGGG - Intronic
1022949326 7:35320756-35320778 ATTCCCCCAGGACTCCTTGTAGG + Intergenic
1024487200 7:49932165-49932187 CCCCAGTGAGGACTCCATGTGGG - Intronic
1024759306 7:52575771-52575793 CTCCCGCCAGCACCCTATGATGG + Intergenic
1033243602 7:139701071-139701093 CTCCCCACAGGACGCCATGCAGG - Intronic
1034326906 7:150244768-150244790 CTCCCACCAGGACCTCATGGTGG + Intronic
1050536430 9:6634679-6634701 GTAGCTCCAGGACTCCATGTGGG + Intronic
1055616974 9:78083185-78083207 CCCCTGCCAGGACTCCATTTTGG - Intergenic
1056689022 9:88790170-88790192 CTCAGGCCAGGTCTCCATGATGG - Intergenic
1057164080 9:92912936-92912958 CTTCCGCCGGGACTCCTTTTTGG + Intergenic
1060046367 9:120344526-120344548 ATCCTCCCAGGACTCCATGTAGG + Intergenic
1187469226 X:19553258-19553280 CTTCTGCCAGGACTCCAGGGAGG + Intronic
1189578609 X:42382264-42382286 CTCTCACCAGGACTGCTTGTTGG + Intergenic
1197414995 X:126164739-126164761 TTCCAGCCTGGACTCCATGCCGG - Exonic