ID: 937932632

View in Genome Browser
Species Human (GRCh38)
Location 2:127218898-127218920
Sequence CACGAAGGGCGCAACGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937932623_937932632 3 Left 937932623 2:127218872-127218894 CCGCGGCTCGGGTGCAGTGCCCC No data
Right 937932632 2:127218898-127218920 CACGAAGGGCGCAACGGAGGTGG No data
937932622_937932632 6 Left 937932622 2:127218869-127218891 CCGCCGCGGCTCGGGTGCAGTGC No data
Right 937932632 2:127218898-127218920 CACGAAGGGCGCAACGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937932632 Original CRISPR CACGAAGGGCGCAACGGAGG TGG Intronic
No off target data available for this crispr