ID: 937937041

View in Genome Browser
Species Human (GRCh38)
Location 2:127254456-127254478
Sequence CAGACAGAACAAAAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937937041_937937052 17 Left 937937041 2:127254456-127254478 CCTCCATCCTTTTGTTCTGTCTG No data
Right 937937052 2:127254496-127254518 TGAGGCCCACCCACGTTGGTGGG No data
937937041_937937053 18 Left 937937041 2:127254456-127254478 CCTCCATCCTTTTGTTCTGTCTG No data
Right 937937053 2:127254497-127254519 GAGGCCCACCCACGTTGGTGGGG No data
937937041_937937047 -1 Left 937937041 2:127254456-127254478 CCTCCATCCTTTTGTTCTGTCTG No data
Right 937937047 2:127254478-127254500 GGTCCCTTGATGGGTATATGAGG No data
937937041_937937050 13 Left 937937041 2:127254456-127254478 CCTCCATCCTTTTGTTCTGTCTG No data
Right 937937050 2:127254492-127254514 TATATGAGGCCCACCCACGTTGG No data
937937041_937937056 22 Left 937937041 2:127254456-127254478 CCTCCATCCTTTTGTTCTGTCTG No data
Right 937937056 2:127254501-127254523 CCCACCCACGTTGGTGGGGGTGG No data
937937041_937937046 -10 Left 937937041 2:127254456-127254478 CCTCCATCCTTTTGTTCTGTCTG No data
Right 937937046 2:127254469-127254491 GTTCTGTCTGGTCCCTTGATGGG No data
937937041_937937054 19 Left 937937041 2:127254456-127254478 CCTCCATCCTTTTGTTCTGTCTG No data
Right 937937054 2:127254498-127254520 AGGCCCACCCACGTTGGTGGGGG No data
937937041_937937051 16 Left 937937041 2:127254456-127254478 CCTCCATCCTTTTGTTCTGTCTG No data
Right 937937051 2:127254495-127254517 ATGAGGCCCACCCACGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937937041 Original CRISPR CAGACAGAACAAAAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr