ID: 937939651

View in Genome Browser
Species Human (GRCh38)
Location 2:127275108-127275130
Sequence CCTTTCTTATGAAGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937939641_937939651 25 Left 937939641 2:127275060-127275082 CCATATAACCCTAAGCCTCTCTT No data
Right 937939651 2:127275108-127275130 CCTTTCTTATGAAGGCTGGGAGG No data
937939645_937939651 10 Left 937939645 2:127275075-127275097 CCTCTCTTGCAAAGTGCTTTGGT No data
Right 937939651 2:127275108-127275130 CCTTTCTTATGAAGGCTGGGAGG No data
937939643_937939651 16 Left 937939643 2:127275069-127275091 CCTAAGCCTCTCTTGCAAAGTGC No data
Right 937939651 2:127275108-127275130 CCTTTCTTATGAAGGCTGGGAGG No data
937939642_937939651 17 Left 937939642 2:127275068-127275090 CCCTAAGCCTCTCTTGCAAAGTG No data
Right 937939651 2:127275108-127275130 CCTTTCTTATGAAGGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937939651 Original CRISPR CCTTTCTTATGAAGGCTGGG AGG Intronic
No off target data available for this crispr