ID: 937939772

View in Genome Browser
Species Human (GRCh38)
Location 2:127275988-127276010
Sequence ACTGGCAGTGTGTGAGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937939768_937939772 6 Left 937939768 2:127275959-127275981 CCTGAGAAGGTGGGGAGGTGCAC No data
Right 937939772 2:127275988-127276010 ACTGGCAGTGTGTGAGTGTGAGG No data
937939766_937939772 13 Left 937939766 2:127275952-127275974 CCAGTTGCCTGAGAAGGTGGGGA No data
Right 937939772 2:127275988-127276010 ACTGGCAGTGTGTGAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937939772 Original CRISPR ACTGGCAGTGTGTGAGTGTG AGG Intronic
No off target data available for this crispr