ID: 937941367

View in Genome Browser
Species Human (GRCh38)
Location 2:127288635-127288657
Sequence AAGTGGTACCAGAGTTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937941367 Original CRISPR AAGTGGTACCAGAGTTAAGA AGG (reversed) Intronic
903789400 1:25882240-25882262 AAGAGGTTCCGGAGTCAAGAAGG - Intergenic
904148668 1:28417712-28417734 AAGTGAAACCACAGATAAGAGGG + Intronic
906365800 1:45208472-45208494 ATGTGGTACCAGATTCAAGGTGG - Intronic
906573563 1:46866589-46866611 AAGTGAAACCACAGATAAGAAGG + Intergenic
906763265 1:48400255-48400277 ATATGGGACCAGAATTAAGATGG - Intronic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
911405330 1:97430913-97430935 AAGTGGAGCCTGAGTTCAGAAGG + Intronic
911664966 1:100541349-100541371 AAGTGGAATCACAGTCAAGACGG + Exonic
913577157 1:120187673-120187695 AAGACTTAACAGAGTTAAGATGG + Intergenic
914559070 1:148799108-148799130 AAGACTTAACAGAGTTAAGATGG + Intergenic
914613763 1:149331122-149331144 AAGACTTAACAGAGTTAAGATGG - Intergenic
917149815 1:171931200-171931222 AAGACGTAACAGTGTTAAGATGG + Intronic
917635646 1:176933166-176933188 AAGAGGTAGCAGAGCTATGATGG - Intronic
919993720 1:202728585-202728607 ATGTGGTAACAGAGTAAACAAGG + Exonic
921395944 1:214669742-214669764 AAGTGGGTCCTGATTTAAGAAGG + Intergenic
921518247 1:216124829-216124851 AAGGGTTACCAGTGTAAAGAAGG + Intronic
922034321 1:221833570-221833592 AAGTACTTCCAGATTTAAGAGGG + Intergenic
924728996 1:246695162-246695184 AAGTGCTACATGAGTTAAGAGGG + Intergenic
1064120841 10:12617372-12617394 AAGTGACGCCAGAGTTAACACGG - Intronic
1064350516 10:14572200-14572222 AACTGGTACCAGAGTTGGTACGG - Intronic
1065630213 10:27672184-27672206 AATTGGTATCAGAGTTAGAAAGG - Intergenic
1065784573 10:29201612-29201634 AAGTAGTCCCAGAGTTTAGCAGG - Intergenic
1067978937 10:51060065-51060087 CAGTGTTACTAGAGTTAAAAAGG - Intronic
1072186656 10:93046511-93046533 AAGAGCTACCTGAGTGAAGAAGG + Intronic
1073304497 10:102492376-102492398 TGGTGGTAGAAGAGTTAAGAAGG - Intronic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1074836192 10:117297527-117297549 AAGTGGTCCCTGACTTATGAGGG + Intronic
1075865213 10:125712811-125712833 AAATGGTCCCTGAGTTTAGAAGG + Intergenic
1080007832 11:27428557-27428579 AAGTGATTGCAGAGTCAAGAAGG + Intronic
1081345229 11:41977615-41977637 AAATGGTACCATCATTAAGAAGG + Intergenic
1083096845 11:60259723-60259745 AAGTTGTACCATATTTAAGTTGG + Intergenic
1085434660 11:76489496-76489518 AAGGGTTACCAGAGATAAAAAGG - Intronic
1085545160 11:77311417-77311439 AAGAGGTACCAGAGTTCTGATGG + Intergenic
1087284874 11:96254707-96254729 AAGTCGTTCCAGAGCAAAGATGG + Intronic
1088456372 11:110036768-110036790 AAGAGGTTCCAGAGATAAGGAGG + Intergenic
1088971798 11:114780443-114780465 ATGTGGTAGAAGAGTTAGGAAGG + Intergenic
1089560854 11:119342453-119342475 AAGTGGTCCCAGAGTCAGGATGG + Intronic
1090299515 11:125623450-125623472 AGCTGGTACGAGATTTAAGAGGG - Intronic
1091723540 12:2830340-2830362 AAGTGGTTCCAGAGATTACAGGG + Intronic
1093568833 12:20642124-20642146 AAGAGGAACCAAAGTTAAAATGG + Intronic
1100958908 12:99940798-99940820 AAGTGGGACCAGAGCTTAGAGGG + Intronic
1101055653 12:100910296-100910318 AAGTGGTAACTGAGATAACAAGG - Intronic
1103895181 12:124268394-124268416 ATGTGGACCCTGAGTTAAGATGG - Intronic
1104066093 12:125307087-125307109 AAGTGGTTGCAGTGTTAAGTAGG - Intronic
1107616950 13:42179714-42179736 AGGTTGTACTAGAGCTAAGATGG + Intronic
1108184892 13:47878702-47878724 AAATGGCACCAGAGTAGAGAAGG - Intergenic
1110250494 13:73375991-73376013 AATTGGTTCCTGAGTTAAGATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111905696 13:94253220-94253242 AAGGGTTACAAGAGATAAGAGGG + Intronic
1112394290 13:99014285-99014307 AACTGGTATCAGAGATTAGAAGG - Intronic
1114795220 14:25707371-25707393 AAGAGGTAGAAGAGTTAATATGG + Intergenic
1115464052 14:33694663-33694685 AAATGGTACCAGTGTTTACATGG + Intronic
1118160996 14:63290174-63290196 CAGAGGTTGCAGAGTTAAGATGG + Intronic
1118820796 14:69344487-69344509 AAGTGGATGCAGAGTTTAGAGGG + Intronic
1119708436 14:76802925-76802947 AAGTGGTTTCAGAGACAAGAAGG + Intronic
1126269289 15:46794428-46794450 AAGTAGTACTATTGTTAAGATGG + Intergenic
1126406711 15:48330294-48330316 AAGTGTTAAAAGAGATAAGATGG + Intergenic
1127095260 15:55506486-55506508 GAGTGTTACTAGAATTAAGAGGG - Intronic
1134030476 16:10988518-10988540 AAGTGGTAGCAGAGTCACAAGGG + Intronic
1137534013 16:49303689-49303711 AAGTAGGAACAGAGTAAAGAAGG + Intergenic
1137889924 16:52148521-52148543 AAGTGTTATCAGATTTATGAAGG - Intergenic
1138680051 16:58677794-58677816 AAGAGATGCCAGAGGTAAGAGGG + Intronic
1140545896 16:75808686-75808708 AAGTGGTAGCAGAGTGACCATGG - Intergenic
1145084545 17:19925787-19925809 AAGAGGGACCAGAATAAAGAGGG + Intronic
1149275488 17:55030240-55030262 ATGTGGTACCGCAGTAAAGATGG - Intronic
1149828688 17:59852171-59852193 CAGAAGTACCAGAGTTCAGAGGG + Intergenic
1149862730 17:60132640-60132662 CAGGAGCACCAGAGTTAAGAAGG - Intergenic
1150707999 17:67505471-67505493 AAATGGTACCAGAGATAAAGTGG - Intronic
1150777167 17:68090506-68090528 AAGTGGTTACAGAGTTAGAAGGG - Intergenic
1150888425 17:69114753-69114775 AAGTGGAACAAGAGGTAGGAGGG - Exonic
1150921659 17:69490449-69490471 AAATGCTACAGGAGTTAAGAAGG + Intronic
1151053686 17:71007750-71007772 AAGTGCTGTCAGAGATAAGAAGG - Intergenic
1156150975 18:34242430-34242452 AAGTGATATAGGAGTTAAGATGG - Intergenic
1157301777 18:46484627-46484649 AAGATGTAGCAGAGTTAAGGGGG + Intronic
1163246729 19:16100256-16100278 AAGGGTTACCAGAGTTCACAAGG + Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
926247915 2:11134100-11134122 AAGTGTGACCAGCGGTAAGAAGG + Intronic
927106049 2:19827026-19827048 GAGTGTTAGCAGAGATAAGAAGG + Intergenic
929041835 2:37751798-37751820 AAGTTGTAAAAGTGTTAAGAAGG - Intergenic
929316708 2:40487911-40487933 AAGTGGTATCAGAGATTAAATGG - Intronic
930531479 2:52594172-52594194 AAGTGCTGCCAGAGTAAACAAGG + Intergenic
931787937 2:65638352-65638374 ATGTTCTACCAGAATTAAGAAGG - Intergenic
935007769 2:99097481-99097503 AAATGGTACAGAAGTTAAGATGG + Intronic
936165800 2:110118198-110118220 AAGTGCTTGCAGAGTTAAGCAGG - Intergenic
937386406 2:121437642-121437664 AACCAGCACCAGAGTTAAGATGG + Intronic
937941367 2:127288635-127288657 AAGTGGTACCAGAGTTAAGAAGG - Intronic
941975186 2:171396396-171396418 GACTGTTACCAGAGATAAGAAGG - Intronic
942509446 2:176681354-176681376 AAGTGGTAGCTGTCTTAAGAGGG + Intergenic
942869403 2:180716526-180716548 ATATGGTACCAGAGATAACATGG + Intergenic
942923296 2:181402828-181402850 AAGTGCTATGAGAGTTGAGAAGG - Intergenic
942973273 2:181982840-181982862 AAGTGATACTGGAGTAAAGATGG - Intronic
947241286 2:227997081-227997103 ATCTGGCACCAGGGTTAAGAAGG - Intronic
1170542841 20:17406528-17406550 AAGTGGTTGCAGAGTTCTGAGGG + Intronic
1177305810 21:19314576-19314598 AAATGGAACCAGAGTTGAAATGG + Intergenic
1178452336 21:32714237-32714259 AAGTGGTAACAGGTTGAAGAGGG + Intronic
1185013098 22:48327203-48327225 AAGTGAAACCACAGATAAGAAGG + Intergenic
1203294048 22_KI270736v1_random:23318-23340 AAGTTGTAAAAGTGTTAAGAAGG - Intergenic
949637068 3:5994742-5994764 TAGTGGTACCAGACATGAGAAGG - Intergenic
950252431 3:11477593-11477615 ATGTGATTCCAAAGTTAAGATGG + Intronic
950679895 3:14577900-14577922 AAGTGAAACCAGAGCTGAGAGGG - Intergenic
954864454 3:53717244-53717266 AGGAGGTTCCAGAGTAAAGAAGG - Intronic
955309437 3:57870229-57870251 AAGTGTTACCATAGCTAAAATGG + Intronic
958669884 3:97190207-97190229 AAGTGGTAACAGTGAAAAGATGG - Intronic
960974934 3:123164353-123164375 AAGGGGCACCAGAATAAAGATGG - Intronic
961965387 3:130896168-130896190 GAATGGTACCAGATTTAAGAGGG + Intronic
962878203 3:139552233-139552255 GAGGGGGACCAGAGTTAGGAGGG + Intergenic
964691141 3:159451277-159451299 ATGTGTCATCAGAGTTAAGAGGG - Intronic
967075134 3:185994980-185995002 AAGTTGTACAGGAGTTACGATGG + Intergenic
968737016 4:2302983-2303005 AGGTGGTTCCAGACTTACGATGG - Intronic
969887247 4:10226119-10226141 AAGTAGTACCAGGGTAAATAAGG - Intergenic
970064902 4:12082266-12082288 AAATGATACCACAGTTGAGAGGG + Intergenic
971097849 4:23428297-23428319 AGGTGGTACCTGAGGTAGGATGG - Intergenic
972350456 4:38231725-38231747 AAGTAGTACCAGATTTCAGCTGG - Intergenic
972466136 4:39358859-39358881 AAGTGGTACTGGGGTTAAGTAGG - Intronic
973072987 4:45888434-45888456 CAGTGGGAGCAGTGTTAAGAGGG - Intergenic
974925422 4:68292148-68292170 AATTGGTACCAGAAATAGGATGG - Intergenic
976382087 4:84411087-84411109 ATGTGGTCCCAGAGTTTAGGAGG - Intergenic
976507417 4:85864291-85864313 AAGTGATATAGGAGTTAAGAAGG - Intronic
979969622 4:127117782-127117804 AAAAAGTTCCAGAGTTAAGATGG - Intergenic
980069320 4:128226753-128226775 AAGTGATTCCAGAGTTAACCAGG + Intergenic
980414885 4:132473615-132473637 AAGAGGTGCCAGTATTAAGAAGG - Intergenic
983025212 4:162727724-162727746 AAATGATACAGGAGTTAAGAAGG - Intergenic
983102687 4:163644816-163644838 CAGTGGGACCAAAGTTAAGCAGG - Intronic
983392003 4:167143891-167143913 AAGTGGCATGAGAGTTAACATGG + Intronic
983461823 4:168034353-168034375 AAGTAAAAACAGAGTTAAGAAGG - Intergenic
983839863 4:172443981-172444003 ATGTGGTAGCAGATTTTAGAGGG + Intronic
984660350 4:182367537-182367559 AAGTGGTAGCAGTGTTGACAGGG + Intronic
985299217 4:188469838-188469860 AAGTGCTACCAGAGAGAAGTAGG + Intergenic
988898720 5:35707952-35707974 AATTTATACAAGAGTTAAGATGG - Intronic
989352163 5:40498911-40498933 AAGTGGAACAAGAATAAAGAAGG + Intergenic
990189929 5:53248657-53248679 AAATGGTTTCAGATTTAAGATGG - Intergenic
990385746 5:55260122-55260144 AAGAGTTACCAGATTTAATAAGG - Intronic
990540752 5:56770615-56770637 AATTGTTACCAGTGTTAAGCTGG - Intergenic
991509419 5:67360425-67360447 AAGGGGTACCAGAGTTGAATAGG - Intergenic
993372099 5:87105520-87105542 AAGTGGAACCACAGTGAAGGTGG + Intergenic
994894040 5:105678491-105678513 AAATTGTAGCAGAGTTAAGTTGG - Intergenic
995731857 5:115253279-115253301 AAGTGGTATGATAGTTAAGATGG - Intronic
996775496 5:127128262-127128284 AAGTGGTATCTGAGTCAAGCTGG + Intergenic
997043526 5:130286163-130286185 AAATTGTACCAGAGTTAAACGGG + Intergenic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
1000454320 5:161430408-161430430 AAGTGATACCAGAGAAAAGTGGG - Intronic
1004894353 6:20132460-20132482 AAGTGGCACCAGTGTCAACAAGG + Intronic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1008118220 6:47578568-47578590 AAGTGTTAAAAGTGTTAAGAAGG + Intronic
1011118581 6:83924651-83924673 CAGTTGTACCAGAGTTTGGAAGG + Intronic
1013273850 6:108565209-108565231 AAGTGATAAAAGAGGTAAGAAGG + Intronic
1015694628 6:135966440-135966462 AAATGCTAGCAGAGTTAAGCAGG + Intronic
1016703735 6:147082676-147082698 AATTGTTTCCAGAGTTCAGAGGG - Intergenic
1016762188 6:147749718-147749740 AAAGGGTAGAAGAGTTAAGAGGG + Intergenic
1020615371 7:10453135-10453157 AAGCTGTACCAGAGTGCAGAAGG + Intergenic
1020624854 7:10565438-10565460 AAGTGGTACTAGAGATAAACAGG + Intergenic
1021455703 7:20827581-20827603 AAGTCATACCAGAGAAAAGATGG + Intergenic
1021580808 7:22150817-22150839 AAGTGTAACCAGTGTTAACATGG - Intronic
1022515101 7:30970254-30970276 AAGTGGTTCCAGAGGAAACAAGG + Intronic
1022782328 7:33599028-33599050 TAGTGGTACCAGAGACCAGATGG + Intronic
1027410030 7:77906333-77906355 AAGTGATACCAGAGTTACGGAGG + Intronic
1027679847 7:81206120-81206142 AATTGGTACGTGATTTAAGACGG + Intergenic
1028774399 7:94660873-94660895 AAAAGAGACCAGAGTTAAGATGG - Intronic
1029306287 7:99622402-99622424 GTGTGGTACCAGAGTGAAAAGGG + Intronic
1032369775 7:131336201-131336223 AAGTGTTACTAGAGATAAAAAGG - Intronic
1033483161 7:141761545-141761567 ATGTGGGAGCAGAGTTGAGAGGG + Intronic
1034522075 7:151628200-151628222 AAGTGGTACCAGAGTAGAGCAGG + Intronic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1037455249 8:19057064-19057086 AAGGGGAACCAGTTTTAAGAAGG - Intronic
1038744055 8:30240881-30240903 AAGCTGTACCAGAGTGCAGAAGG + Intergenic
1039016005 8:33149505-33149527 AAGTGTAACCAGATTGAAGATGG - Intergenic
1039046803 8:33458054-33458076 AAGAGGTAACTGAGTTAAAACGG + Intronic
1040046362 8:42967940-42967962 AAGTTGTTTCAGTGTTAAGAAGG - Intronic
1040904657 8:52453978-52454000 AAGTAGTAACAGAGATAAAAAGG + Intronic
1041216455 8:55606382-55606404 CAGTGGTACCAGAGTCCTGATGG - Intergenic
1042094563 8:65199406-65199428 AGGTGCTACCAGAGATAAGAGGG - Intergenic
1043965172 8:86465957-86465979 AAGTGGTGACAGTGGTAAGAAGG + Intronic
1044034256 8:87278925-87278947 AAGTGAAACCACAGATAAGAAGG - Intronic
1045999771 8:108405807-108405829 AAATGGGACAAGATTTAAGAAGG - Intronic
1046387185 8:113520149-113520171 AGGAGGTACCAGAGTAAACAGGG - Intergenic
1046414304 8:113891421-113891443 AAGTGAAACCATAGATAAGAAGG - Intergenic
1047664135 8:127071266-127071288 AAGTGGTAGCAGAGTTCAAGAGG + Intergenic
1048671009 8:136719833-136719855 AACTTCTACCACAGTTAAGATGG + Intergenic
1051115021 9:13684814-13684836 AAGTGAAACCAGAGATAAGGGGG - Intergenic
1051854781 9:21551578-21551600 AAGCAGTACCTGGGTTAAGAGGG - Intergenic
1052227998 9:26112281-26112303 AAGTGTTACCAGTGCCAAGAAGG + Intronic
1053152123 9:35749763-35749785 AAGTGGTAGCAGAGCTCAGCCGG + Exonic
1055945981 9:81690869-81690891 AAGTGGAACTTGAGTTAAAAGGG + Intergenic
1056005567 9:82266977-82266999 AAGTTGTACCAGTGTTTAAATGG + Intergenic
1057293000 9:93819057-93819079 AAGTGCTGCTGGAGTTAAGACGG + Intergenic
1057347474 9:94263338-94263360 AAGTGTTACCAGAGATACAAAGG - Intronic
1058669796 9:107351237-107351259 AACAGGTGCCAGAGTTCAGATGG + Intergenic
1059677378 9:116552320-116552342 AATTGGTGTCAGAGTTAAGGGGG + Intronic
1060980196 9:127787156-127787178 AAGTTGTACTAGAGCTAAGATGG - Intronic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1188808487 X:34621634-34621656 AAGTGGCACTAGAGTGAAGGCGG + Intergenic
1190950294 X:55136981-55137003 AAGAGGTGCCAGAGTTAATGAGG + Intronic
1191719797 X:64219992-64220014 GGGTGGTACAAGAGTCAAGAAGG + Intergenic
1195093975 X:101488709-101488731 AAATGGATCCACAGTTAAGATGG + Exonic
1195966167 X:110432107-110432129 AAGAGGGAGAAGAGTTAAGAGGG + Intronic
1196132239 X:112169549-112169571 TTGTGGCACCAGAGTTAATAAGG + Intergenic
1196354532 X:114774922-114774944 AAGCGGTACCAGAGTGCAGGAGG - Intronic
1196636285 X:118006747-118006769 AACTGGTACCACTGTTAAGTTGG + Intronic
1197878330 X:131135583-131135605 AAGTGTCACCAGAGATAAGGAGG + Intergenic
1201707237 Y:16950429-16950451 AAGTGATACCAGAGCAAACATGG + Intergenic