ID: 937942150

View in Genome Browser
Species Human (GRCh38)
Location 2:127294210-127294232
Sequence TCTTCCAGCCACCCACATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937942150_937942158 29 Left 937942150 2:127294210-127294232 CCGTGATGTGGGTGGCTGGAAGA 0: 1
1: 1
2: 5
3: 38
4: 252
Right 937942158 2:127294262-127294284 GCTCGTGCGACCCAGCGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 45
937942150_937942159 30 Left 937942150 2:127294210-127294232 CCGTGATGTGGGTGGCTGGAAGA 0: 1
1: 1
2: 5
3: 38
4: 252
Right 937942159 2:127294263-127294285 CTCGTGCGACCCAGCGGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
937942150_937942155 24 Left 937942150 2:127294210-127294232 CCGTGATGTGGGTGGCTGGAAGA 0: 1
1: 1
2: 5
3: 38
4: 252
Right 937942155 2:127294257-127294279 TGTTAGCTCGTGCGACCCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 18
937942150_937942157 28 Left 937942150 2:127294210-127294232 CCGTGATGTGGGTGGCTGGAAGA 0: 1
1: 1
2: 5
3: 38
4: 252
Right 937942157 2:127294261-127294283 AGCTCGTGCGACCCAGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 47
937942150_937942156 27 Left 937942150 2:127294210-127294232 CCGTGATGTGGGTGGCTGGAAGA 0: 1
1: 1
2: 5
3: 38
4: 252
Right 937942156 2:127294260-127294282 TAGCTCGTGCGACCCAGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937942150 Original CRISPR TCTTCCAGCCACCCACATCA CGG (reversed) Intergenic