ID: 937942152

View in Genome Browser
Species Human (GRCh38)
Location 2:127294241-127294263
Sequence GCTAACAGATCGGCGGTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937942152_937942159 -1 Left 937942152 2:127294241-127294263 CCAGCGACCGCCGATCTGTTAGC 0: 1
1: 0
2: 0
3: 1
4: 17
Right 937942159 2:127294263-127294285 CTCGTGCGACCCAGCGGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
937942152_937942157 -3 Left 937942152 2:127294241-127294263 CCAGCGACCGCCGATCTGTTAGC 0: 1
1: 0
2: 0
3: 1
4: 17
Right 937942157 2:127294261-127294283 AGCTCGTGCGACCCAGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 47
937942152_937942156 -4 Left 937942152 2:127294241-127294263 CCAGCGACCGCCGATCTGTTAGC 0: 1
1: 0
2: 0
3: 1
4: 17
Right 937942156 2:127294260-127294282 TAGCTCGTGCGACCCAGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
937942152_937942158 -2 Left 937942152 2:127294241-127294263 CCAGCGACCGCCGATCTGTTAGC 0: 1
1: 0
2: 0
3: 1
4: 17
Right 937942158 2:127294262-127294284 GCTCGTGCGACCCAGCGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 45
937942152_937942155 -7 Left 937942152 2:127294241-127294263 CCAGCGACCGCCGATCTGTTAGC 0: 1
1: 0
2: 0
3: 1
4: 17
Right 937942155 2:127294257-127294279 TGTTAGCTCGTGCGACCCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937942152 Original CRISPR GCTAACAGATCGGCGGTCGC TGG (reversed) Intergenic