ID: 937942153

View in Genome Browser
Species Human (GRCh38)
Location 2:127294248-127294270
Sequence CGCACGAGCTAACAGATCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 7}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937942153_937942158 -9 Left 937942153 2:127294248-127294270 CCGCCGATCTGTTAGCTCGTGCG 0: 1
1: 0
2: 0
3: 0
4: 7
Right 937942158 2:127294262-127294284 GCTCGTGCGACCCAGCGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 45
937942153_937942157 -10 Left 937942153 2:127294248-127294270 CCGCCGATCTGTTAGCTCGTGCG 0: 1
1: 0
2: 0
3: 0
4: 7
Right 937942157 2:127294261-127294283 AGCTCGTGCGACCCAGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 47
937942153_937942159 -8 Left 937942153 2:127294248-127294270 CCGCCGATCTGTTAGCTCGTGCG 0: 1
1: 0
2: 0
3: 0
4: 7
Right 937942159 2:127294263-127294285 CTCGTGCGACCCAGCGGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
937942153_937942164 24 Left 937942153 2:127294248-127294270 CCGCCGATCTGTTAGCTCGTGCG 0: 1
1: 0
2: 0
3: 0
4: 7
Right 937942164 2:127294295-127294317 GTTCATTTCTCTACAACTGAAGG 0: 1
1: 0
2: 3
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937942153 Original CRISPR CGCACGAGCTAACAGATCGG CGG (reversed) Intergenic