ID: 937942159 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:127294263-127294285 |
Sequence | CTCGTGCGACCCAGCGGCGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 48 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 44} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937942153_937942159 | -8 | Left | 937942153 | 2:127294248-127294270 | CCGCCGATCTGTTAGCTCGTGCG | 0: 1 1: 0 2: 0 3: 0 4: 7 |
||
Right | 937942159 | 2:127294263-127294285 | CTCGTGCGACCCAGCGGCGGGGG | 0: 1 1: 0 2: 0 3: 3 4: 44 |
||||
937942150_937942159 | 30 | Left | 937942150 | 2:127294210-127294232 | CCGTGATGTGGGTGGCTGGAAGA | 0: 1 1: 1 2: 5 3: 38 4: 252 |
||
Right | 937942159 | 2:127294263-127294285 | CTCGTGCGACCCAGCGGCGGGGG | 0: 1 1: 0 2: 0 3: 3 4: 44 |
||||
937942152_937942159 | -1 | Left | 937942152 | 2:127294241-127294263 | CCAGCGACCGCCGATCTGTTAGC | 0: 1 1: 0 2: 0 3: 1 4: 17 |
||
Right | 937942159 | 2:127294263-127294285 | CTCGTGCGACCCAGCGGCGGGGG | 0: 1 1: 0 2: 0 3: 3 4: 44 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937942159 | Original CRISPR | CTCGTGCGACCCAGCGGCGG GGG | Intergenic | ||