ID: 937942159

View in Genome Browser
Species Human (GRCh38)
Location 2:127294263-127294285
Sequence CTCGTGCGACCCAGCGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937942153_937942159 -8 Left 937942153 2:127294248-127294270 CCGCCGATCTGTTAGCTCGTGCG 0: 1
1: 0
2: 0
3: 0
4: 7
Right 937942159 2:127294263-127294285 CTCGTGCGACCCAGCGGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
937942150_937942159 30 Left 937942150 2:127294210-127294232 CCGTGATGTGGGTGGCTGGAAGA 0: 1
1: 1
2: 5
3: 38
4: 252
Right 937942159 2:127294263-127294285 CTCGTGCGACCCAGCGGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
937942152_937942159 -1 Left 937942152 2:127294241-127294263 CCAGCGACCGCCGATCTGTTAGC 0: 1
1: 0
2: 0
3: 1
4: 17
Right 937942159 2:127294263-127294285 CTCGTGCGACCCAGCGGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937942159 Original CRISPR CTCGTGCGACCCAGCGGCGG GGG Intergenic