ID: 937944152

View in Genome Browser
Species Human (GRCh38)
Location 2:127316112-127316134
Sequence TCCCAATGTCGTGGGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937944152_937944163 27 Left 937944152 2:127316112-127316134 CCTGCAATCCCACGACATTGGGA No data
Right 937944163 2:127316162-127316184 TCAGGAGTTTGAGACCAGCCTGG 0: 43524
1: 116818
2: 176857
3: 202641
4: 129199
937944152_937944161 9 Left 937944152 2:127316112-127316134 CCTGCAATCCCACGACATTGGGA No data
Right 937944161 2:127316144-127316166 AGGCGGGATCACCTGAGGTCAGG 0: 15
1: 154
2: 3059
3: 50969
4: 105550
937944152_937944159 -7 Left 937944152 2:127316112-127316134 CCTGCAATCCCACGACATTGGGA No data
Right 937944159 2:127316128-127316150 ATTGGGAGGTCGAGGCAGGCGGG No data
937944152_937944160 4 Left 937944152 2:127316112-127316134 CCTGCAATCCCACGACATTGGGA No data
Right 937944160 2:127316139-127316161 GAGGCAGGCGGGATCACCTGAGG No data
937944152_937944158 -8 Left 937944152 2:127316112-127316134 CCTGCAATCCCACGACATTGGGA No data
Right 937944158 2:127316127-127316149 CATTGGGAGGTCGAGGCAGGCGG 0: 10
1: 1100
2: 32584
3: 125099
4: 173781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937944152 Original CRISPR TCCCAATGTCGTGGGATTGC AGG (reversed) Intronic
No off target data available for this crispr