ID: 937944243

View in Genome Browser
Species Human (GRCh38)
Location 2:127317243-127317265
Sequence CTTAAAAAGAAGTAGAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937944243_937944245 18 Left 937944243 2:127317243-127317265 CCTTGTCTCTACTTCTTTTTAAG No data
Right 937944245 2:127317284-127317306 AAGAAGAGAGAGATAATTAAGGG No data
937944243_937944246 19 Left 937944243 2:127317243-127317265 CCTTGTCTCTACTTCTTTTTAAG No data
Right 937944246 2:127317285-127317307 AGAAGAGAGAGATAATTAAGGGG No data
937944243_937944244 17 Left 937944243 2:127317243-127317265 CCTTGTCTCTACTTCTTTTTAAG No data
Right 937944244 2:127317283-127317305 TAAGAAGAGAGAGATAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937944243 Original CRISPR CTTAAAAAGAAGTAGAGACA AGG (reversed) Intronic
No off target data available for this crispr