ID: 937944307

View in Genome Browser
Species Human (GRCh38)
Location 2:127318284-127318306
Sequence TTGCCCAATCTCCAGTTGGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937944304_937944307 -8 Left 937944304 2:127318269-127318291 CCTTGGCCAAGCAGTTTGCCCAA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 937944307 2:127318284-127318306 TTGCCCAATCTCCAGTTGGTCGG 0: 1
1: 0
2: 1
3: 7
4: 123
937944302_937944307 5 Left 937944302 2:127318256-127318278 CCTTCCAAAGGCTCCTTGGCCAA 0: 1
1: 0
2: 2
3: 17
4: 225
Right 937944307 2:127318284-127318306 TTGCCCAATCTCCAGTTGGTCGG 0: 1
1: 0
2: 1
3: 7
4: 123
937944301_937944307 6 Left 937944301 2:127318255-127318277 CCCTTCCAAAGGCTCCTTGGCCA 0: 1
1: 0
2: 2
3: 17
4: 238
Right 937944307 2:127318284-127318306 TTGCCCAATCTCCAGTTGGTCGG 0: 1
1: 0
2: 1
3: 7
4: 123
937944303_937944307 1 Left 937944303 2:127318260-127318282 CCAAAGGCTCCTTGGCCAAGCAG 0: 1
1: 0
2: 2
3: 19
4: 177
Right 937944307 2:127318284-127318306 TTGCCCAATCTCCAGTTGGTCGG 0: 1
1: 0
2: 1
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937944307 Original CRISPR TTGCCCAATCTCCAGTTGGT CGG Exonic
900763740 1:4489615-4489637 TTGCCCAGGCTCCAGCTGATAGG - Intergenic
902568855 1:17333626-17333648 CTGCCCCATCTCCAGCTGCTGGG + Intronic
906958968 1:50403485-50403507 TTGCCCAGTCTTCTGTTGATGGG - Intergenic
908660081 1:66425816-66425838 TTGCCCAAAACCCCGTTGGTGGG - Intergenic
911477473 1:98391216-98391238 CTGCCCTATCTCCTGTTGGTGGG + Intergenic
915025006 1:152819721-152819743 TTACACAATGTCCAGATGGTGGG - Intergenic
921014310 1:211173858-211173880 TTTCCAAATGTACAGTTGGTTGG - Intergenic
922082771 1:222313793-222313815 TTGACCAATTGACAGTTGGTGGG - Intergenic
922153009 1:223021180-223021202 TAGCCCAATATCCAGTTTCTGGG - Intergenic
1063229747 10:4052935-4052957 TTGTCCAATCTCCTGTTGGTAGG - Intergenic
1072046160 10:91657245-91657267 TTACCCATTCTCCTGTTGATGGG + Intergenic
1073719775 10:106154867-106154889 TTCCCCAATCCCCAGTTCCTGGG + Intergenic
1078381547 11:10846519-10846541 TTCCCCAATCTTCATTTGATTGG + Intronic
1079937705 11:26638164-26638186 TAGCCCATTCTCAAGATGGTGGG - Intronic
1080022901 11:27582061-27582083 TTTCCAAATGTACAGTTGGTTGG - Intergenic
1080078289 11:28179655-28179677 TTGTCCATTCTCCTGTTGATGGG + Intronic
1080640871 11:34157610-34157632 CTGCCCATTCTCCAGTGAGTTGG + Intronic
1083348150 11:62008454-62008476 TTACCCAATCACCAGTTGATGGG - Intergenic
1086283985 11:85223901-85223923 CTGCACAATATCCAGTTGGAAGG - Intronic
1087672335 11:101122607-101122629 TTGGCCAAAAACCAGTTGGTTGG - Intronic
1087698936 11:101413609-101413631 TTGCAGTATCTCCATTTGGTGGG + Intergenic
1090630466 11:128643036-128643058 TTGTCCAATCTACTGTTGATGGG - Intergenic
1091338054 11:134787589-134787611 TTGTCCCATCTTCAGCTGGTGGG - Intergenic
1094422544 12:30286484-30286506 TTCTCCATTCACCAGTTGGTAGG + Intergenic
1099577069 12:84394530-84394552 TTGCCCAAAGCCCTGTTGGTGGG - Intergenic
1107411497 13:40162508-40162530 TGGCCCTATCTCCAGTTAGGAGG - Intergenic
1107740208 13:43442435-43442457 TTGCCCTATCTCCCAGTGGTGGG - Intronic
1108141124 13:47422759-47422781 TTTCACAATCTCCTGTTGCTTGG + Intergenic
1109129688 13:58567228-58567250 TTGCCCATTTTCTAGTTGGATGG + Intergenic
1109254192 13:60058619-60058641 TTATCCACTCACCAGTTGGTGGG - Intronic
1111567282 13:90032632-90032654 TTGCTCAGCCTCCAGTTGTTTGG + Intergenic
1112441188 13:99426217-99426239 ATGACCAATCTGCCGTTGGTGGG - Intergenic
1116284105 14:42950006-42950028 TTATCCAATCCACAGTTGGTGGG + Intergenic
1123410315 15:20053376-20053398 TTGCCCAGTCTCCATGTTGTGGG - Intergenic
1123519648 15:21060083-21060105 TTGCCCAGTCTCCATGTTGTGGG - Intergenic
1126495080 15:49281185-49281207 TTGTCCAATATCCAGTTTATTGG - Intronic
1127123251 15:55789090-55789112 TTGTTCAATCACCAGTTTGTTGG - Intergenic
1127369383 15:58323146-58323168 TTACCCAATCCACTGTTGGTGGG + Intronic
1130347398 15:83060716-83060738 TTACCCAATCTCCGCTTGCTGGG - Intronic
1135575026 16:23579159-23579181 TTACCCAGTCTGCAGTTGATGGG - Intergenic
1138978110 16:62232884-62232906 TTATCCAGTCTCCAGTTGATGGG - Intergenic
1139067723 16:63338901-63338923 TTATCCAATCTACAGTTGATGGG + Intergenic
1140425942 16:74861437-74861459 ATGCAAAGTCTCCAGTTGGTTGG - Intergenic
1140721978 16:77780312-77780334 TTGGCCTATATCCAGTTGGTTGG - Intergenic
1141472413 16:84248074-84248096 TTGTCCATTCTCCTGTTAGTGGG - Intergenic
1143463818 17:7122101-7122123 TTGCCCAGTCTGCAGTAGGGTGG - Intergenic
1145082254 17:19903577-19903599 TTGCCCACACACCAGTTGATTGG - Intergenic
1153139200 18:1953492-1953514 TTAGCCAATCACCTGTTGGTGGG + Intergenic
1154216437 18:12419971-12419993 TTGCCCCACCTCCAGTAGCTGGG - Intronic
1154298838 18:13175090-13175112 TTTCCCATTTTCCAGTTGCTTGG - Intergenic
1155684850 18:28536141-28536163 TGACCCAATCTACAGTTGATGGG - Intergenic
1156754174 18:40500773-40500795 TTGCCCAAAGTCCAGATGTTTGG + Intergenic
1158790106 18:60769073-60769095 GTGCCCAATGTTCAGTTTGTTGG + Intergenic
1165476218 19:36032500-36032522 TTGCCCAAGATCCAGTTGCGCGG - Intronic
1165729405 19:38135210-38135232 TTGCTCTCTCTCCACTTGGTGGG + Intronic
925787930 2:7451321-7451343 ATGCCCAATGTCAAGTTGATGGG - Intergenic
929268110 2:39941420-39941442 TTGCTGAATCTTCACTTGGTGGG + Intergenic
935701327 2:105814669-105814691 TTCCTCACTCTCCAGTCGGTTGG + Intronic
937944307 2:127318284-127318306 TTGCCCAATCTCCAGTTGGTCGG + Exonic
942592805 2:177563762-177563784 TTGCCCACTCTCCTGTTGATGGG + Intergenic
942954843 2:181762110-181762132 CTCTCCAACCTCCAGTTGGTGGG + Intergenic
946891268 2:224279612-224279634 TTGCCCAATTTCAACTTGGCGGG - Intergenic
1170590329 20:17766652-17766674 TTATCCAATCTCCTGTTGATAGG + Intergenic
1177526858 21:22304440-22304462 TTGCCCAATCTGCCTTTGATGGG - Intergenic
1177886391 21:26750988-26751010 TTCCCCAATCTGCCGTTGATGGG - Intergenic
1180831479 22:18909168-18909190 TTCCCCAATCTCCTGTTTCTTGG - Intronic
1183171657 22:36192929-36192951 TTGGCCAAACTTCAGTTGGGCGG + Intronic
1184849275 22:47110740-47110762 TTCCCCAAACTCCAGTTCTTGGG - Intronic
1203281563 22_KI270734v1_random:134439-134461 TTCCCCAATCTCCTGTTTCTTGG - Intergenic
951650106 3:24941841-24941863 TTGCCCAATTTACAGTTAGGAGG + Intergenic
953390656 3:42531882-42531904 TTTCCCCATCTCTAGGTGGTGGG - Intronic
954347677 3:50013877-50013899 TTGCCAAATGTCCAGTGGTTGGG - Intronic
955230688 3:57096632-57096654 GTGCCCCATCTTGAGTTGGTTGG - Intronic
955503466 3:59607634-59607656 GTGCCCAATCTTCAGGTGGTGGG + Intergenic
960567676 3:119151919-119151941 TTGTCCAACCTGCAGTTTGTGGG - Intronic
962102154 3:132354050-132354072 TTGGCCAGTCTCCATTTTGTGGG - Intronic
962817908 3:139019757-139019779 GTGCCCAATTTCCAGGTTGTTGG + Exonic
965341602 3:167498249-167498271 TTGCCCAACCTCCAGAGGGAAGG - Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
970020829 4:11566675-11566697 TTGCCCATTCTTCAGTTGAATGG + Intergenic
978363169 4:107952367-107952389 TGGCCTAGTCTCCAGGTGGTGGG - Exonic
978522375 4:109629905-109629927 CTGCCCAATCTCCAGGAAGTGGG - Intronic
978637373 4:110825418-110825440 TTATCCAATCTACAGTTGATGGG + Intergenic
981358797 4:143823746-143823768 TTGCCCAGTCTCCATTTCATGGG - Intergenic
982404160 4:155002075-155002097 AAGCCAAATCTCCAGTGGGTGGG - Intergenic
984326606 4:178262325-178262347 TTACCCATTCTACAGTTGATGGG - Intergenic
985292541 4:188401294-188401316 TTGCCTAATCTCCAGGCCGTGGG - Intergenic
986058883 5:4168991-4169013 TTGTCCACTCTCAAGTTGATGGG - Intergenic
990433948 5:55768512-55768534 TTGTCCAGTCTACTGTTGGTGGG + Intronic
990756370 5:59075394-59075416 TTGCGGAATCTCCAATTGGGAGG - Intronic
991009468 5:61867954-61867976 GTGTCCAAACACCAGTTGGTAGG + Intergenic
994372302 5:98980915-98980937 TGGCCCATTTTCCAGTTGGGTGG - Intergenic
998257014 5:140595693-140595715 TTGGCCAAACTCCAGGAGGTTGG - Intergenic
1002224219 5:177707212-177707234 ATGCACATTCTGCAGTTGGTGGG - Intergenic
1003858272 6:10297864-10297886 ATGGCCAATCACCAGTTGGAAGG - Intergenic
1004826259 6:19424775-19424797 AAGCCTACTCTCCAGTTGGTGGG + Intergenic
1005775138 6:29123233-29123255 TTACCCAATCTACTGTTGATGGG - Intergenic
1005781200 6:29194469-29194491 TTACCCAATCTACTGTTGATGGG - Intergenic
1007284187 6:40736067-40736089 GTGGCCAATCTCCAGCTGGTGGG - Intergenic
1011256334 6:85425365-85425387 TTGTCCAATCCACAGTTGGTGGG - Intergenic
1012165525 6:95945927-95945949 TTGCCCAATCCACTGTTTGTGGG + Intergenic
1013442003 6:110179959-110179981 TTGCCCAATCCTCAGTTTGGGGG + Exonic
1014483248 6:121965083-121965105 TTTTCCAATCACCTGTTGGTGGG + Intergenic
1017572487 6:155761724-155761746 TGGCCCAATCTCCAGTAGAGTGG + Intergenic
1020369944 7:7421094-7421116 TTGTCCATTCACCAGTTGATGGG - Intronic
1020482795 7:8682676-8682698 ATGCCCAAAGTCTAGTTGGTGGG - Intronic
1020560843 7:9727586-9727608 TTCCCCAACCTGCAGTGGGTGGG - Intergenic
1023915433 7:44585141-44585163 TTGCCAAATTTCCCCTTGGTAGG - Intergenic
1024357483 7:48429175-48429197 TTGTCCATTCACCAGTTGATGGG + Intronic
1026266865 7:68802858-68802880 TTGTCCAATCTATCGTTGGTGGG + Intergenic
1030546334 7:110900800-110900822 TTGCCAAATGTCCAGAGGGTGGG + Intronic
1031188689 7:118517986-118518008 TTGCCCAATCTTCAGTGACTTGG + Intergenic
1032252351 7:130269156-130269178 TTGCCCAATGTCCTGTAGTTGGG - Intronic
1033003370 7:137532591-137532613 TTCATCAATCTACAGTTGGTGGG + Intronic
1035112648 7:156496084-156496106 TTGTCCATTTTCCAGTGGGTGGG - Intergenic
1037794027 8:21976503-21976525 TTACCTGATCTCCAGCTGGTGGG - Exonic
1040548031 8:48416934-48416956 TTGTCCATTCTTCTGTTGGTAGG - Intergenic
1042509061 8:69592230-69592252 TAGCCCATTCTCCAGTTTCTAGG - Intronic
1043748860 8:83909915-83909937 TTCCCCAAGCTCCAATTAGTTGG + Intergenic
1045707897 8:104947810-104947832 AAGCCCAATGTCCATTTGGTGGG - Intronic
1051389903 9:16552707-16552729 CTGCACAATCTCCACTTGGGTGG + Exonic
1051714206 9:19964595-19964617 TTGCCATATGTCCACTTGGTTGG + Intergenic
1056428587 9:86504232-86504254 TTGCCAAATTACGAGTTGGTTGG + Intergenic
1062642959 9:137530902-137530924 GTGCCCAATCTCCTGGTGCTGGG + Intronic
1186624411 X:11277265-11277287 TTGTCCATTCTTCAGTTGATGGG + Intronic
1186952324 X:14640756-14640778 TTGTCCGTTCTCCTGTTGGTGGG + Intronic
1187821980 X:23297557-23297579 TTGGCCACTCTCCAGCTGGAAGG + Intergenic
1188382494 X:29513428-29513450 TTAACCAATCTCCAATTGATGGG + Intronic
1189277012 X:39794064-39794086 TAGTCCAATGTCCAGTTTGTAGG - Intergenic
1195414111 X:104601994-104602016 TTATCCAATCTACTGTTGGTGGG - Intronic
1197818904 X:130526841-130526863 TTGTCCAGTCTCCTGTTGATAGG - Intergenic
1200758638 Y:7015863-7015885 TTAATCAATCTCCAGTTGATTGG + Intronic