ID: 937949053

View in Genome Browser
Species Human (GRCh38)
Location 2:127369653-127369675
Sequence ATTTGTGAACAGCCCTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937949053_937949056 5 Left 937949053 2:127369653-127369675 CCGTGGGAGGGCTGTTCACAAAT No data
Right 937949056 2:127369681-127369703 TTTTTATCCTTCTGGGCATATGG No data
937949053_937949055 -2 Left 937949053 2:127369653-127369675 CCGTGGGAGGGCTGTTCACAAAT No data
Right 937949055 2:127369674-127369696 ATACTTGTTTTTATCCTTCTGGG No data
937949053_937949054 -3 Left 937949053 2:127369653-127369675 CCGTGGGAGGGCTGTTCACAAAT No data
Right 937949054 2:127369673-127369695 AATACTTGTTTTTATCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937949053 Original CRISPR ATTTGTGAACAGCCCTCCCA CGG (reversed) Intronic
No off target data available for this crispr