ID: 937950994

View in Genome Browser
Species Human (GRCh38)
Location 2:127387897-127387919
Sequence ACGAGGGTGCCGCGGCCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937950994_937951001 -4 Left 937950994 2:127387897-127387919 CCCAGCGGCCGCGGCACCCTCGT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 937951001 2:127387916-127387938 TCGTCAGGCGCCGCCGCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 16
937950994_937951000 -5 Left 937950994 2:127387897-127387919 CCCAGCGGCCGCGGCACCCTCGT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 937951000 2:127387915-127387937 CTCGTCAGGCGCCGCCGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 60
937950994_937951002 0 Left 937950994 2:127387897-127387919 CCCAGCGGCCGCGGCACCCTCGT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 937951002 2:127387920-127387942 CAGGCGCCGCCGCTGAGGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 335
937950994_937951004 8 Left 937950994 2:127387897-127387919 CCCAGCGGCCGCGGCACCCTCGT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 937951004 2:127387928-127387950 GCCGCTGAGGGCAGGCAGCCCGG 0: 1
1: 0
2: 2
3: 50
4: 396
937950994_937951006 24 Left 937950994 2:127387897-127387919 CCCAGCGGCCGCGGCACCCTCGT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937950994 Original CRISPR ACGAGGGTGCCGCGGCCGCT GGG (reversed) Intronic
900486497 1:2925165-2925187 ACGAGGGTGCTGGGGACTCTTGG + Intergenic
901678761 1:10901442-10901464 ACCAGGGTGCCAGGGCCCCTGGG - Intergenic
902786814 1:18738318-18738340 CCGGGGCTGCCGCTGCCGCTGGG - Intronic
903350231 1:22712479-22712501 ACGTGGGGGCTGCGGCCTCTGGG + Intronic
907917300 1:58882789-58882811 AAGAGGCTGCCGGGGCAGCTGGG - Intergenic
910936078 1:92485353-92485375 CCGAGGGTCCCGCTGCAGCTTGG + Intronic
918047079 1:180948063-180948085 GCGAGGGTGCCGGGGGCCCTGGG - Exonic
922804414 1:228378113-228378135 ACGAGGGTGCAGGGGCCGTGAGG - Intronic
1062843103 10:686383-686405 ATGAGGGTGCGGAGGCCCCTCGG - Intronic
1063929713 10:11017638-11017660 AAGAGGCCGCCGTGGCCGCTCGG - Intronic
1073137724 10:101229019-101229041 ACGCGGGCGCCGCTGCTGCTGGG + Exonic
1084794392 11:71495480-71495502 AGGTGGGTTCCGCTGCCGCTGGG + Intronic
1110630108 13:77697883-77697905 CCGAGGGCGCCGCGGCCGCCGGG - Intronic
1114612540 14:24052196-24052218 ACGAGGCTGCCTCGGTCTCTGGG + Intronic
1127433432 15:58933798-58933820 TCGAGCGGGCCGCGGCCACTTGG + Intronic
1131047704 15:89326623-89326645 AGGAAGGTGCTGGGGCCGCTTGG + Exonic
1132831241 16:1929528-1929550 GCGGGGGTGGCGCGGCCGGTGGG - Intergenic
1138507712 16:57486431-57486453 GCGAGGGAGGCGCGGCCGCAGGG + Exonic
1141452728 16:84116671-84116693 GCGAGCGGGCCGCCGCCGCTAGG + Intronic
1145314390 17:21720765-21720787 ACCAGGGTGCCGGGGCTGCACGG + Intergenic
1152822852 17:82446001-82446023 ACGGGGGCCCCGTGGCCGCTGGG + Intronic
1153855200 18:9137551-9137573 GGGAGTCTGCCGCGGCCGCTCGG + Intronic
1160453409 18:78979991-78980013 AGGAGGGGGCCGCGGCGCCTCGG - Intergenic
1161256849 19:3314599-3314621 AGGAGGGTGCCGGGGACACTGGG - Intergenic
1163551135 19:17967054-17967076 ACGCGGGAGCCGCCGCCGATTGG - Intronic
1164595822 19:29530166-29530188 CCGAGGCTGCCGCGGCCTCGGGG - Exonic
1165058866 19:33195166-33195188 ACGAGGGGGCCCCGGGAGCTGGG + Intronic
1165732114 19:38152560-38152582 AGGAGGGGGCAGAGGCCGCTTGG - Intronic
1166808045 19:45498639-45498661 ACGGGGGTGCCGAGGCGTCTGGG + Exonic
1168695347 19:58400973-58400995 AAGAGGGTGCCGCGACGGCCGGG - Intergenic
928313749 2:30231178-30231200 AGGAGGGCGCGGGGGCCGCTCGG - Intergenic
928430573 2:31215093-31215115 ACTAGGGTGCCGCTACCTCTTGG - Intronic
937950994 2:127387897-127387919 ACGAGGGTGCCGCGGCCGCTGGG - Intronic
947712425 2:232323751-232323773 CAGAGGGTGCCGTGGCCTCTGGG - Intronic
947719814 2:232363566-232363588 CAGAGGGTGCCGTGGCCTCTGGG - Intergenic
947731384 2:232433431-232433453 CAGAGGGTGCCGTGGCCTCTGGG - Intergenic
1172841065 20:37903075-37903097 AGGAGGGTGCGGCGGCGGCGCGG + Intergenic
1175116465 20:56686022-56686044 ACGAGGGGGCCGCAGCTGCCAGG - Intergenic
1182667594 22:31970864-31970886 CTGAGGGAGCCGCGGCCGCCAGG + Intergenic
956659532 3:71583934-71583956 AAGAGGGAGCCGCTCCCGCTCGG - Intronic
968764678 4:2462275-2462297 AGGAGCGCGCCGCGGCCCCTGGG + Intronic
969213282 4:5704345-5704367 AGGAGGGTGCCAAGGCCTCTGGG + Intronic
969535951 4:7756184-7756206 CCGTGGGTGCCGTGGCCCCTGGG - Intergenic
986597511 5:9439078-9439100 ATGAGGGTGCCTGGGCTGCTGGG - Intronic
986695846 5:10353846-10353868 ACGAGGCTCCCGCGGCCGGGCGG - Exonic
989368568 5:40681677-40681699 CCGAGGCGGCCGCGGCCGCGTGG - Exonic
990954747 5:61331298-61331320 ACGCGGGTCGCGCGGCTGCTGGG + Intergenic
998095674 5:139394479-139394501 AGGAGGGCGCCGCGCCCGCCAGG - Exonic
1002021215 5:176365561-176365583 CCGATGGCGCCGCGGCCGCTGGG + Exonic
1002160658 5:177312277-177312299 ACGTGGGTGCCGCGGGGGCGGGG + Exonic
1002176435 5:177403810-177403832 ACGGAGGAGCCGCGGCCCCTGGG + Intronic
1011128875 6:84034202-84034224 AAGGGTGTGCCTCGGCCGCTGGG - Intronic
1013538821 6:111087792-111087814 ACGAGCGAGGCGCAGCCGCTCGG + Exonic
1019589860 7:1825550-1825572 ACCTGGGTGCCCTGGCCGCTGGG - Intronic
1023638417 7:42236480-42236502 CCGCGGGGGCCGCCGCCGCTGGG - Intronic
1028762338 7:94509915-94509937 TCGGGGGCGCCGCGGCCGCGGGG + Exonic
1033253228 7:139777910-139777932 GCTCGGGGGCCGCGGCCGCTCGG - Intronic
1049566347 8:143341121-143341143 AAGAGGGTGGCGGGGACGCTAGG - Intronic
1057921969 9:99105100-99105122 GCGAGGCCGCCGCGGCGGCTAGG + Exonic
1060855887 9:126914901-126914923 GCGAAGGCGCCGCTGCCGCTGGG + Exonic
1061263783 9:129494218-129494240 CCCAGGGTGCTGCGGCAGCTGGG - Intergenic
1061502020 9:131009405-131009427 ACGTGGGCGCCGCGGGCGCGGGG + Exonic
1061540633 9:131276557-131276579 GCGAGGGTGGCGCGGCCGCGCGG - Intergenic
1062435958 9:136546650-136546672 ATGGGGGCGCCGCGGCCTCTGGG + Intergenic
1062554108 9:137106336-137106358 ACGGGGGAGCCGCGGGAGCTGGG - Intronic
1185457622 X:318721-318743 CCGCGTGGGCCGCGGCCGCTCGG - Exonic