ID: 937950995

View in Genome Browser
Species Human (GRCh38)
Location 2:127387898-127387920
Sequence GACGAGGGTGCCGCGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937950995_937951002 -1 Left 937950995 2:127387898-127387920 CCAGCGGCCGCGGCACCCTCGTC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 937951002 2:127387920-127387942 CAGGCGCCGCCGCTGAGGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 335
937950995_937951004 7 Left 937950995 2:127387898-127387920 CCAGCGGCCGCGGCACCCTCGTC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 937951004 2:127387928-127387950 GCCGCTGAGGGCAGGCAGCCCGG 0: 1
1: 0
2: 2
3: 50
4: 396
937950995_937951006 23 Left 937950995 2:127387898-127387920 CCAGCGGCCGCGGCACCCTCGTC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data
937950995_937951001 -5 Left 937950995 2:127387898-127387920 CCAGCGGCCGCGGCACCCTCGTC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 937951001 2:127387916-127387938 TCGTCAGGCGCCGCCGCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 16
937950995_937951000 -6 Left 937950995 2:127387898-127387920 CCAGCGGCCGCGGCACCCTCGTC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 937951000 2:127387915-127387937 CTCGTCAGGCGCCGCCGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937950995 Original CRISPR GACGAGGGTGCCGCGGCCGC TGG (reversed) Intronic
900081815 1:864213-864235 GAGGAGGGTGCTGAGGCCTCTGG - Intergenic
901678762 1:10901443-10901465 GACCAGGGTGCCAGGGCCCCTGG - Intergenic
902184741 1:14716882-14716904 GAAGAGGGTGCCACTGCCGGGGG + Intronic
902786816 1:18738319-18738341 GCCGGGGCTGCCGCTGCCGCTGG - Intronic
903350230 1:22712478-22712500 GACGTGGGGGCTGCGGCCTCTGG + Intronic
903651491 1:24925235-24925257 AAGGAGGGTGCCGGGTCCGCTGG - Intronic
905862591 1:41361352-41361374 GCTGAGGATTCCGCGGCCGCAGG + Intergenic
906140484 1:43531200-43531222 GACGAGGGCGCCGCTGAGGCCGG + Intronic
907038326 1:51236333-51236355 GACGCCGGAGCCACGGCCGCGGG - Exonic
907069200 1:51518990-51519012 GGCGAGGTCGCGGCGGCCGCAGG + Intronic
907653739 1:56321393-56321415 GAGGAGGGGGCGGTGGCCGCAGG - Intergenic
915367393 1:155323739-155323761 GACGAGGTTGCGGTGGCAGCGGG - Intronic
915902164 1:159854975-159854997 GACGCGGCTGCCGCGCCCGCTGG + Exonic
918047080 1:180948064-180948086 GGCGAGGGTGCCGGGGGCCCTGG - Exonic
918470583 1:184868891-184868913 GACGAGGGTTCTGGGGCAGCTGG - Intronic
1065099531 10:22320630-22320652 GAAGAGGCCGGCGCGGCCGCGGG + Intronic
1066464236 10:35639514-35639536 GGCGCGGGCGCCACGGCCGCGGG - Exonic
1073137723 10:101229018-101229040 GACGCGGGCGCCGCTGCTGCTGG + Exonic
1073446597 10:103584673-103584695 GACGAGGCCGCGCCGGCCGCCGG + Exonic
1077339760 11:2021063-2021085 GACGTGGGTGCCCCAGACGCAGG - Intergenic
1079238416 11:18705914-18705936 GACGAGGGTGCACACGCCGCTGG + Exonic
1079450781 11:20598298-20598320 GCCGCGGCGGCCGCGGCCGCAGG - Intergenic
1080551342 11:33376228-33376250 GCCGAGGCTGCAGCGGCGGCGGG + Intergenic
1081938175 11:46918671-46918693 GACCAGGGAGCCGGGGCCGAGGG - Intergenic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1084257935 11:67955428-67955450 GCCGGGGGTGCCGGGGACGCGGG - Intergenic
1085208148 11:74749316-74749338 GACGGGGGCGCGGCTGCCGCGGG + Exonic
1085395745 11:76206389-76206411 GACGATGAGGGCGCGGCCGCAGG - Exonic
1088648520 11:111937440-111937462 GAGGAGGCGGCGGCGGCCGCCGG + Intronic
1089533874 11:119149255-119149277 GACGCGGGTGCCGCAGCCCGAGG + Exonic
1090660131 11:128876275-128876297 GAATAGGGTGCCGACGCCGCAGG + Intergenic
1202822745 11_KI270721v1_random:76252-76274 GACGTGGGTGCCCCAGACGCAGG - Intergenic
1091450561 12:569953-569975 GACTTGGGCGCCGCGGCTGCCGG + Intronic
1092143802 12:6201092-6201114 GGCAGGGGTGCCTCGGCCGCGGG + Intronic
1095976055 12:47941912-47941934 GGCGAGGGAGCCGCGGCTGTGGG + Intronic
1096078395 12:48818593-48818615 GGCGAGGGGGCGGCGGCCACCGG - Intronic
1101102434 12:101407588-101407610 CTCGAGGGAGCCGCGGCCGAGGG - Intronic
1101131713 12:101697558-101697580 GAGGCGGGTGCCGCGCTCGCGGG - Intronic
1101409505 12:104457108-104457130 GACCAGGCAGCGGCGGCCGCCGG + Exonic
1105368533 13:19782645-19782667 GCCATGGCTGCCGCGGCCGCCGG + Exonic
1110630110 13:77697884-77697906 CCCGAGGGCGCCGCGGCCGCCGG - Intronic
1110705970 13:78602240-78602262 GTCGTGGGCGCCGCCGCCGCCGG + Exonic
1116895603 14:50312329-50312351 GGCCAGGGTGCCGCAGACGCGGG + Exonic
1122543295 14:102509481-102509503 GAGGAGGGGGCGGCGGCCGCGGG + Intronic
1123041121 14:105490625-105490647 GAGGAGGCTGCCGCGGGCTCCGG + Intronic
1125852817 15:42920721-42920743 GACGAGGCGGCGGCGGCGGCAGG - Intronic
1132831242 16:1929529-1929551 GGCGGGGGTGGCGCGGCCGGTGG - Intergenic
1133055169 16:3142177-3142199 GAGCAGGGTGCCGGGGCCGATGG - Exonic
1133156459 16:3880153-3880175 GATGAGGGGGCCGCGGCCGGCGG - Exonic
1138507711 16:57486430-57486452 GGCGAGGGAGGCGCGGCCGCAGG + Exonic
1140187379 16:72787456-72787478 GAGGAGGGGGCGGCGGCCGACGG + Exonic
1141682983 16:85554920-85554942 GGGGAGGGTGCCGCTGCCGAAGG - Intergenic
1141828540 16:86497196-86497218 GCCGATCGCGCCGCGGCCGCCGG - Intergenic
1142136437 16:88453843-88453865 GACGCGGGGGCCCAGGCCGCCGG - Intronic
1142160338 16:88554283-88554305 GACGAGGGTCCTGTGGCTGCTGG + Intergenic
1142231695 16:88903107-88903129 GACGATGGTGCTGGGGCCCCGGG - Intronic
1146277166 17:31523244-31523266 GAAGAGGGTTCTGAGGCCGCAGG + Intronic
1149863880 17:60139724-60139746 GAGGAGGGGGCCGCGGGCGAAGG - Intergenic
1150002698 17:61451754-61451776 GCCCAGGGGGCCGCGGGCGCTGG - Intergenic
1152824989 17:82458945-82458967 GCCCAGGGTGCCGAGGCCGGGGG - Intronic
1160967774 19:1754101-1754123 GGCGGGGGCGGCGCGGCCGCCGG - Exonic
1161103630 19:2433113-2433135 GATCAGGGTGACGGGGCCGCCGG - Intronic
1161163373 19:2772844-2772866 GAGGTGGGTGACGCGGCCACAGG + Intronic
1161163546 19:2773500-2773522 GAGGTGGGTGACGCGGCCACAGG + Intronic
1161256850 19:3314600-3314622 GAGGAGGGTGCCGGGGACACTGG - Intergenic
1162635334 19:11963666-11963688 GACGGGGGTGCTGTGGCAGCTGG - Intronic
1162954680 19:14091277-14091299 GACGCGGGGGCGGCGGCAGCAGG - Intergenic
1163767189 19:19170261-19170283 GATCAGGGGCCCGCGGCCGCAGG + Intronic
1164595824 19:29530167-29530189 GCCGAGGCTGCCGCGGCCTCGGG - Exonic
1165058865 19:33195165-33195187 GACGAGGGGGCCCCGGGAGCTGG + Intronic
1165068532 19:33242135-33242157 CACGAGGGGGCCCCTGCCGCAGG - Intergenic
1165129267 19:33622015-33622037 GACGAGGCGGCGGCGGCAGCAGG + Intronic
1165893007 19:39125987-39126009 GAGGAGGGGGGCGGGGCCGCCGG + Intronic
1166105731 19:40597251-40597273 CAGGAGGGGGCGGCGGCCGCTGG - Exonic
1166224048 19:41383953-41383975 GATGAGGCTGCGGCGGCGGCAGG + Exonic
1168076389 19:53982742-53982764 GGCGCGGGTGGCGCGGGCGCGGG - Exonic
1168335027 19:55592727-55592749 GACGGGGGTTCCCCGGACGCCGG + Exonic
1168695348 19:58400974-58400996 CAAGAGGGTGCCGCGACGGCCGG - Intergenic
927809718 2:26174169-26174191 GACGAGGAGCCTGCGGCCGCGGG - Intronic
932756762 2:74414890-74414912 GACACGGGTGCCGGGGCCGAGGG + Exonic
933751130 2:85602620-85602642 GAGCAGGGTGCGGCGGCGGCGGG - Intronic
937284527 2:120741711-120741733 GCCGACCGTGCCGCGGCCGGGGG + Intronic
937950995 2:127387898-127387920 GACGAGGGTGCCGCGGCCGCTGG - Intronic
938397856 2:130963973-130963995 GGCGGCGGTGCGGCGGCCGCGGG - Intronic
940300894 2:152175711-152175733 GTCTAGGGAGCCGCGGCCGCGGG - Exonic
946247473 2:218396025-218396047 GGCGTGGGAGTCGCGGCCGCCGG - Exonic
946419061 2:219554711-219554733 GCTGAGGGTGCTGCGGCCTCTGG - Exonic
947712426 2:232323752-232323774 GCAGAGGGTGCCGTGGCCTCTGG - Intronic
947719815 2:232363567-232363589 GCAGAGGGTGCCGTGGCCTCTGG - Intergenic
947731385 2:232433432-232433454 GCAGAGGGTGCCGTGGCCTCTGG - Intergenic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
948370521 2:237486689-237486711 CAGGAGGGTCCCGCAGCCGCGGG - Intronic
1168804321 20:663591-663613 GGCGAGGGCGCTGCGGGCGCAGG + Exonic
1174425892 20:50431291-50431313 GGCGTGGCTGCCGCGGCCACAGG - Intergenic
1175429129 20:58890319-58890341 GAGGAGGGCGCCGCCGCCGGGGG + Intronic
1175847123 20:62065041-62065063 GGCGAGGGCGCGGCGGGCGCGGG + Exonic
1175847334 20:62065644-62065666 GAGGTGCGGGCCGCGGCCGCCGG - Exonic
1175922887 20:62458374-62458396 GACCAGGGTCCCGAGGCCACGGG + Intergenic
1175926964 20:62475818-62475840 GACGGGCCTGGCGCGGCCGCAGG + Intronic
1175992510 20:62796735-62796757 GGCGAGGGTGTCGCGAGCGCAGG - Intronic
1177188065 21:17819437-17819459 GGGGAGGGTGGCGCGGCCGCGGG + Intergenic
1178921058 21:36738572-36738594 GAGGAGGGAGCAGCGGCCTCTGG - Intronic
1184101448 22:42343607-42343629 GGCGAGGACGCGGCGGCCGCGGG - Intronic
1184150694 22:42636685-42636707 GACGAGGCAGCGGCGGCGGCCGG + Intronic
1184523057 22:45007328-45007350 GACGAGGTTGGGGCGGCTGCCGG - Intronic
1184886143 22:47345423-47345445 GAGGAGGGAGCTGGGGCCGCAGG + Intergenic
1185330812 22:50251353-50251375 GCCGAGGCTTCCGCGCCCGCTGG - Exonic
950006000 3:9691364-9691386 GACAAGGGTGGTGCGGCAGCAGG - Intronic
954028740 3:47803252-47803274 GAGGAGCCTGCCGCGGCCGGGGG + Intronic
956658948 3:71581522-71581544 GTCGAGGCGGCCGCGGGCGCGGG - Intronic
958900134 3:99876267-99876289 GCCGAGGGTCCCGCGGTCACCGG - Intronic
968815194 4:2818281-2818303 GACGAGGCGGCGGCGGCCGGGGG + Exonic
969535953 4:7756185-7756207 GCCGTGGGTGCCGTGGCCCCTGG - Intergenic
977810035 4:101347393-101347415 GCCGCTGGTGCCGCGGCCGCCGG + Exonic
982139961 4:152307865-152307887 GGTGAGGGTGCTGCTGCCGCAGG + Intergenic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
983398495 4:167233915-167233937 GAGGCGGGGGCCGCGGCCGCCGG - Intronic
985521663 5:376636-376658 GGCGAGGGGGCGCCGGCCGCAGG - Exonic
985844500 5:2334355-2334377 GACGAGGGTGCAGGGGGCACTGG + Intergenic
990954746 5:61331297-61331319 GACGCGGGTCGCGCGGCTGCTGG + Intergenic
994072885 5:95621074-95621096 GACCAGGGCGCTGCAGCCGCGGG - Exonic
996862776 5:128084126-128084148 GATGAGGGCCCCGCGGCGGCCGG + Exonic
999726984 5:154445896-154445918 GGCGGGGCTGCCGCCGCCGCTGG - Intergenic
1002021213 5:176365560-176365582 CCCGATGGCGCCGCGGCCGCTGG + Exonic
1002160657 5:177312276-177312298 CACGTGGGTGCCGCGGGGGCGGG + Exonic
1002176434 5:177403809-177403831 GACGGAGGAGCCGCGGCCCCTGG + Intronic
1002204505 5:177553778-177553800 GCTGAGGGGGCCGCGGCTGCAGG + Intronic
1002330807 5:178439241-178439263 GATGATGGTGCCGGGGCCTCTGG - Intronic
1004044673 6:12012375-12012397 GACCGGGGAGCGGCGGCCGCCGG + Exonic
1010032989 6:71289138-71289160 GACGAGGACGCCGAGGCGGCGGG + Exonic
1013793705 6:113860481-113860503 GACGAGGCTGCGGCGGCCGCGGG - Exonic
1016010793 6:139135631-139135653 GCCGCGGGGGCTGCGGCCGCGGG + Exonic
1017174918 6:151493966-151493988 GAGTAGGGTGGCCCGGCCGCAGG - Intergenic
1020004561 7:4775496-4775518 GGCGTAGGTGCCGCGGCCGGGGG - Intronic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1025258491 7:57400789-57400811 GACCAGGGAGCCGTGGCCACAGG - Intergenic
1025709248 7:63891880-63891902 GACCAGGGAGCCGTGGCCACAGG - Intergenic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1029413640 7:100430226-100430248 GAGGAGGTGGCCGCGGCCCCGGG - Exonic
1034217979 7:149422466-149422488 GGTGAGGGCGCCGCGGCCTCCGG + Intergenic
1035153338 7:156893005-156893027 GACGCGGGCGGCGCGGCGGCGGG - Exonic
1035523455 8:293340-293362 GAGGAGGGTGCTGAGGCCTCTGG + Intergenic
1035630184 8:1101508-1101530 GACGGGGGTGCCGGGGCTGGGGG + Intergenic
1037825217 8:22156567-22156589 GGGGCGGGGGCCGCGGCCGCCGG - Exonic
1048980886 8:139703065-139703087 GAGGAGGCGGCGGCGGCCGCCGG - Intergenic
1051170173 9:14313779-14313801 GCCGAGGCCGCCGCCGCCGCCGG + Intronic
1057600127 9:96450454-96450476 GACGAGGCGGCGGCGGCGGCCGG + Exonic
1061327599 9:129873750-129873772 GAGGAGGCTGCCGAGGCCACTGG - Intronic
1061502019 9:131009404-131009426 CACGTGGGCGCCGCGGGCGCGGG + Exonic
1062435957 9:136546649-136546671 GATGGGGGCGCCGCGGCCTCTGG + Intergenic
1185450776 X:280185-280207 GCCCAGGGTCCCGGGGCCGCGGG - Intronic
1190267316 X:48835276-48835298 GACGAGGGTGGCCCGGGCTCCGG - Intronic
1200233606 X:154458179-154458201 GCCGAGGGGGACGCGGCGGCAGG - Intergenic