ID: 937950997

View in Genome Browser
Species Human (GRCh38)
Location 2:127387905-127387927
Sequence GGCGCCTGACGAGGGTGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937950997_937951006 16 Left 937950997 2:127387905-127387927 CCGCGGCACCCTCGTCAGGCGCC 0: 1
1: 0
2: 2
3: 7
4: 90
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data
937950997_937951002 -8 Left 937950997 2:127387905-127387927 CCGCGGCACCCTCGTCAGGCGCC 0: 1
1: 0
2: 2
3: 7
4: 90
Right 937951002 2:127387920-127387942 CAGGCGCCGCCGCTGAGGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 335
937950997_937951010 30 Left 937950997 2:127387905-127387927 CCGCGGCACCCTCGTCAGGCGCC 0: 1
1: 0
2: 2
3: 7
4: 90
Right 937951010 2:127387958-127387980 TACACACGGACCCGTGACGTCGG No data
937950997_937951004 0 Left 937950997 2:127387905-127387927 CCGCGGCACCCTCGTCAGGCGCC 0: 1
1: 0
2: 2
3: 7
4: 90
Right 937951004 2:127387928-127387950 GCCGCTGAGGGCAGGCAGCCCGG 0: 1
1: 0
2: 2
3: 50
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937950997 Original CRISPR GGCGCCTGACGAGGGTGCCG CGG (reversed) Intronic
900102416 1:967503-967525 GCTGCCTGACGGGGGTGCAGTGG - Intronic
900341921 1:2193682-2193704 GCCGTCTGTGGAGGGTGCCGCGG - Exonic
900432486 1:2609446-2609468 GAGGCCTGACGAGGCTGCAGGGG + Intronic
901689775 1:10965169-10965191 GGGGCCTGAGAAGGGTGACGGGG + Intronic
902286204 1:15410088-15410110 GGCACCCGACGAGGCGGCCGAGG + Exonic
903765570 1:25732109-25732131 GGCTCCTGCAGAGGGTGCCCAGG + Intronic
903954001 1:27012569-27012591 GCCGCCTGCCGGGGCTGCCGTGG + Exonic
915218089 1:154353165-154353187 GGCGCCTGCGGAGGGAGCCCGGG - Intergenic
922586689 1:226738723-226738745 GGCGCCGGGCGAGGCTGCCCGGG - Intronic
923006647 1:230055243-230055265 GGGGCCTGACAATGGTGCTGCGG - Intergenic
923146814 1:231203979-231204001 GGAGCTGGACGACGGTGCCGGGG + Exonic
1077158605 11:1102586-1102608 GGCGCACGATGAGGGTGCGGGGG - Intergenic
1078901992 11:15650450-15650472 GGGCCCTCACGAGGGTGCCAGGG - Intergenic
1087461714 11:98455300-98455322 GGCACCTGCCAAGGTTGCCGGGG - Intergenic
1090204331 11:124876326-124876348 TGCGGCTGGCGAGGGTGCTGCGG + Exonic
1093685052 12:22046120-22046142 GGCCCCAGACGAGGCGGCCGCGG + Intergenic
1102046280 12:109832277-109832299 GGCTCCTGAGGAGGGTGACGAGG - Intronic
1103538718 12:121651523-121651545 GGGGCCCTATGAGGGTGCCGGGG + Exonic
1103564899 12:121810615-121810637 GGGGCGTGACGAGGGGGGCGTGG - Exonic
1103565309 12:121812248-121812270 GGGGCCAGCCGAGGGTGCAGGGG + Intronic
1103852675 12:123943520-123943542 GGTGCCTGAAGAGGGTCCCAGGG + Intronic
1107324263 13:39224105-39224127 GGAGCCTGTCGAGGGGGCGGGGG + Intergenic
1110706110 13:78603000-78603022 GGCGCCTGACGCGGAGGCAGAGG + Intronic
1113633513 13:111904364-111904386 AGCGCCTGACAAGGCAGCCGTGG + Intergenic
1117602564 14:57390614-57390636 GGCGGCTGTGGAGGCTGCCGCGG + Exonic
1119444682 14:74653370-74653392 TGGGCCTGCTGAGGGTGCCGTGG + Intergenic
1122743480 14:103885086-103885108 GGCTCCTGAGGAGGGGGCCCTGG + Intergenic
1122985807 14:105211161-105211183 GGAGCCTGACGAGGAGGACGGGG - Exonic
1123041118 14:105490618-105490640 AGCGCCTGAGGAGGCTGCCGCGG + Intronic
1124252011 15:28113110-28113132 GGGGCCGGACGAGGCTGCCCAGG - Exonic
1126891140 15:53205650-53205672 GGGGCCTGATGGGGGTGGCGGGG - Intergenic
1130979606 15:88803537-88803559 GGCGTCTGACGCGGGTGCCAGGG + Exonic
1132584204 16:699270-699292 GAGGCCTGAGGAGGGTGCCCGGG - Intronic
1132864684 16:2087505-2087527 GGCGGCTGAGGAGGGTGTGGTGG + Intronic
1134644430 16:15855004-15855026 GGTAACTGACGAGGGGGCCGGGG + Intronic
1134646590 16:15872667-15872689 GTCGCCTGACTAGAGTGCAGTGG - Intronic
1136220220 16:28823571-28823593 GGCTCCGGGCGAGGGAGCCGCGG + Intronic
1142009089 16:87704600-87704622 GGCGCCTGGGGAGGGTCCTGGGG + Intronic
1142280050 16:89143293-89143315 GGCAGCTCAAGAGGGTGCCGGGG + Intronic
1145980105 17:29006038-29006060 AGCGCCTGGCGACGGCGCCGGGG + Exonic
1148553420 17:48564161-48564183 GGGGCCTGGCGGGGGTGCAGAGG - Intronic
1150485039 17:65537548-65537570 GGCGCCCGGCGAGGCGGCCGCGG + Exonic
1157625562 18:49047897-49047919 GGTGACTGACCAGGATGCCGTGG - Intronic
1160710510 19:549043-549065 GGCGCCTGTCCCGGGTGCTGCGG + Exonic
1161055932 19:2190644-2190666 GGCACCTGACGGGGGTCCCTTGG + Intronic
1161256851 19:3314607-3314629 GGAGTCGGAGGAGGGTGCCGGGG - Intergenic
1162021167 19:7869251-7869273 GGCGGCTGCCGAGGGTGCCGCGG - Exonic
1165427803 19:35755476-35755498 GGAGCCTGAGGAGGCTCCCGGGG + Exonic
1166045300 19:40226450-40226472 GACGCCTGGCGAGGCCGCCGGGG - Exonic
1167290809 19:48624426-48624448 GGCGTGTGAGGAGGGTGCGGGGG + Intronic
1168401559 19:56088409-56088431 CGCGCCGGGCGAGGGGGCCGCGG - Exonic
1168519536 19:57037472-57037494 GCCCCATGAGGAGGGTGCCGTGG - Intergenic
937950997 2:127387905-127387927 GGCGCCTGACGAGGGTGCCGCGG - Intronic
939629481 2:144516228-144516250 GGGGACTAGCGAGGGTGCCGGGG - Intronic
946054541 2:216889324-216889346 GGCTCCTGGCGAGGGAGCAGTGG - Intergenic
947517990 2:230823690-230823712 GGGGCCAGAGGAGAGTGCCGAGG - Intergenic
948465187 2:238148748-238148770 GGGGCCTGTGGAGGGTGCAGGGG - Intronic
949077879 2:242072822-242072844 GGCTTCTGAAGAAGGTGCCGCGG - Intergenic
1171848241 20:30290719-30290741 GGCGGCTGAGGAGGCTGGCGCGG - Intergenic
1175328392 20:58145741-58145763 GGCGCCTGAAGAGGGCTCCCAGG + Intergenic
1175786788 20:61717014-61717036 GGGCCATGACGAGGGTGCAGAGG - Intronic
1177166717 21:17612466-17612488 GGCGCCCGCCGAGGGTCCCGCGG + Intronic
1178768911 21:35484130-35484152 GGGGCCTGAAGAGGGTGGTGTGG - Intronic
1184475989 22:44721731-44721753 GGCCACAGACAAGGGTGCCGAGG + Intronic
1184841246 22:47053446-47053468 TGCGCCTGACGAGGCGGCCCTGG - Intronic
1185045449 22:48526288-48526310 GGCTCCTGGCCAGGGTGCAGGGG - Intronic
1185113695 22:48919302-48919324 TCCTCCTGACGAGGGTGCAGCGG + Intergenic
1185160935 22:49229444-49229466 GGTGCATGACGAGGGAGCAGGGG - Intergenic
955080010 3:55649746-55649768 GGCACATGACGGGGGTGCCCTGG - Intronic
957498898 3:81027836-81027858 GGGGCCTGTCGAGGGTTCGGGGG - Intergenic
961551330 3:127672151-127672173 GGCACCTGTGGAGGGTGCCGCGG + Intronic
969490237 4:7495542-7495564 GGGGCCTGACGAGGGTGCCAAGG - Intronic
974144223 4:57926471-57926493 GGTGCCTGAGGAGTGTGCTGAGG - Intergenic
991053992 5:62302808-62302830 AGCACCAGACGAGGCTGCCGAGG + Intergenic
996862725 5:128083968-128083990 GGCGCCGGAGGAGGGCGCCGTGG - Exonic
997485167 5:134225483-134225505 GGCGCCAGACGAGGTGGCAGGGG - Intronic
1001506377 5:172283725-172283747 GGCGCCGGAGGAGGCTGCAGCGG - Exonic
1006808305 6:36803242-36803264 GGCCCCTTAGGAGGTTGCCGTGG - Intronic
1010032985 6:71289131-71289153 CGCGCCGGACGAGGACGCCGAGG + Exonic
1014137735 6:117907909-117907931 GGCGCCGGGCGAGGGCGCGGGGG + Intronic
1019536201 7:1530997-1531019 GGCGCGGGCCGAGGGTGGCGGGG + Intronic
1022095674 7:27139637-27139659 GGCGCCGGCCGCGGGCGCCGAGG - Intronic
1025205666 7:56992163-56992185 TGCGGGTGACGAGGGTGACGTGG + Intergenic
1025666274 7:63584775-63584797 TGCGGGTGACGAGGGTGACGTGG - Intergenic
1034629897 7:152522776-152522798 GGCTCCTGACGAGGCTGGCTGGG + Intergenic
1034951255 7:155298167-155298189 GCCGCCTGGCCCGGGTGCCGGGG + Intronic
1035239615 7:157521146-157521168 GGCGCCTGGCGAGGGTTCGGTGG + Intergenic
1035266577 7:157692972-157692994 GGCACCGGAGGAGGGTGGCGGGG - Intronic
1038254956 8:25942576-25942598 GCCGCCTGAGGAGGGGGCTGGGG - Intronic
1040928881 8:52714122-52714144 GGCGGCGGAAGATGGTGCCGGGG - Exonic
1044280722 8:90352319-90352341 AGCGAATGACGATGGTGCCGAGG + Intergenic
1051689688 9:19697272-19697294 GGGGCCTGCCGGGGGTGCAGCGG + Intronic
1058176025 9:101737695-101737717 TGCGCCCGGCGAGGGCGCCGGGG + Exonic
1060177867 9:121510774-121510796 GGGGCCTGGCGCGGGTGCGGTGG - Intergenic
1060431230 9:123552734-123552756 GGCCCCTGAGGCGGGTGCCAGGG - Intronic
1187225448 X:17372094-17372116 GAAGCCTGACTAGGGTTCCGTGG + Intergenic
1190666535 X:52701289-52701311 GTCGCCAGACTGGGGTGCCGTGG + Intronic
1190672883 X:52757119-52757141 GTCGCCAGACTGGGGTGCCGTGG - Intronic
1191184297 X:57592777-57592799 GGCGCCTGAGGAGGAGGCGGAGG + Exonic
1200178660 X:154136849-154136871 GGCGCCAGAAGAGGGCGCCCGGG + Intergenic