ID: 937950998

View in Genome Browser
Species Human (GRCh38)
Location 2:127387913-127387935
Sequence TCAGCGGCGGCGCCTGACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937950998_937951010 22 Left 937950998 2:127387913-127387935 CCCTCGTCAGGCGCCGCCGCTGA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 937951010 2:127387958-127387980 TACACACGGACCCGTGACGTCGG No data
937950998_937951004 -8 Left 937950998 2:127387913-127387935 CCCTCGTCAGGCGCCGCCGCTGA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 937951004 2:127387928-127387950 GCCGCTGAGGGCAGGCAGCCCGG 0: 1
1: 0
2: 2
3: 50
4: 396
937950998_937951011 23 Left 937950998 2:127387913-127387935 CCCTCGTCAGGCGCCGCCGCTGA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 937951011 2:127387959-127387981 ACACACGGACCCGTGACGTCGGG No data
937950998_937951006 8 Left 937950998 2:127387913-127387935 CCCTCGTCAGGCGCCGCCGCTGA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937950998 Original CRISPR TCAGCGGCGGCGCCTGACGA GGG (reversed) Intronic
900698365 1:4027105-4027127 TCCGTGGCGGCCCCTGACGCCGG + Intergenic
906027057 1:42682692-42682714 ACATCGGCGGCGCCTGCCGGCGG + Exonic
920266886 1:204730648-204730670 TCAGAGGCGCCGCCGGACTAAGG + Intergenic
920348456 1:205321827-205321849 TCGACGGCGGCGCGTGACCACGG + Intergenic
922333465 1:224598267-224598289 TCAGAAGCGGAGCCTGAAGATGG + Intronic
1064202877 10:13299651-13299673 TCACCGGCGGCGCGTGACCCCGG - Intronic
1069279500 10:66637546-66637568 TCAGAGGCTGAGCCTGACAACGG - Intronic
1075389546 10:122082873-122082895 CCAGCAGCGGCACCTGAAGATGG + Exonic
1077442375 11:2574710-2574732 TCAGCAGTGGCTCCTGACGTAGG + Intronic
1085253556 11:75159453-75159475 TCAGGGGTGGCCCCTGACAAAGG + Intronic
1096580451 12:52581447-52581469 TCAGCGGGGGCCCATGACAATGG - Intergenic
1096654397 12:53079447-53079469 TCAGCAACGGCCTCTGACGACGG + Intergenic
1096786370 12:54019206-54019228 TCGGCAGAGGCGTCTGACGAGGG + Intronic
1099286327 12:80717336-80717358 CGAGCGGAGGCGCCTGAAGAAGG + Exonic
1105216463 13:18289491-18289513 TCAGCGGAAGAGCCTGATGAAGG + Intergenic
1114266671 14:21076399-21076421 GCAGTGGAGGTGCCTGACGAAGG - Exonic
1118463876 14:66013653-66013675 ACATCGGCGGCGCCTGCCGGCGG - Intergenic
1121234707 14:92383779-92383801 TCAGAGGAGGAGGCTGACGAGGG - Intronic
1125500564 15:40238316-40238338 TCAGAGGTGGCGCCTGAAGTGGG + Intergenic
1125815648 15:42581613-42581635 GCAGGGGCGGAGCCAGACGAGGG - Intronic
1137020817 16:35425482-35425504 TCTGAGGCGGCGCCTGGCGACGG - Intergenic
1143524249 17:7463125-7463147 TGAGATGCGGCGCTTGACGATGG + Exonic
1151337338 17:73447692-73447714 TCAACGGTGGCCCCTGACGCAGG - Exonic
1152728593 17:81959447-81959469 TCAGCGGCGGGCCCTGGGGAAGG - Intronic
1160712309 19:558042-558064 TGAGCGACGGCGCCTGACCTTGG - Intergenic
1161707267 19:5828026-5828048 CCAGCGGCGGCGCCTGCGGCGGG + Exonic
1163720487 19:18896138-18896160 CCAGCTGCGGCGCGTGACGCGGG - Intronic
1164413143 19:28022198-28022220 TCAGCAGAGGCCCCTGATGAGGG - Intergenic
927816700 2:26223690-26223712 TCAGCAGAGGCACCTGAAGAAGG - Intronic
934297864 2:91757233-91757255 TCAGCAGAAGAGCCTGACGAAGG - Intergenic
935679196 2:105621362-105621384 CCAGCTGCTGCCCCTGACGATGG - Intergenic
937950998 2:127387913-127387935 TCAGCGGCGGCGCCTGACGAGGG - Intronic
938562751 2:132489282-132489304 ACAGCGCCGGCGCCTGCCAATGG - Intronic
944553185 2:200864275-200864297 GAAGCGGCGCCGCCTGACGCGGG - Exonic
948378566 2:237538099-237538121 CCAGCACCGGCTCCTGACGATGG + Intronic
1172180084 20:32997604-32997626 TCAGCTGTGGGGCCTGAGGAGGG + Intronic
1175266956 20:57709192-57709214 TCAGCGGCGGCGCACGGCGCGGG - Intronic
1184046736 22:41976792-41976814 GCAGCGGCGGCGGCTGGCGGCGG + Exonic
960208375 3:114930633-114930655 TCACAGGCGGCGCCTGCTGATGG + Intronic
968437434 4:601305-601327 TCAGAGGCGGAGGCTGACGCAGG - Intergenic
975365877 4:73527051-73527073 TCAGCAGAGGCACCTGAGGAAGG - Intergenic
982712290 4:158769267-158769289 TCCGCGGCGGCGTCTGCCCAGGG + Exonic
983071212 4:163270062-163270084 TCAGCAGCGGCTCCTGAGCAAGG - Intergenic
983606610 4:169593703-169593725 TGAGCCACGGCGCCTGACCAGGG - Intronic
988564910 5:32312974-32312996 TCAGCGGCGGAGCCGGATGCGGG - Exonic
992528102 5:77630667-77630689 GCAGCGGCGGCGGCAGCCGACGG + Exonic
1007784222 6:44270839-44270861 GCAGCGGCGGCGGCGGACGAGGG + Exonic
1014137731 6:117907901-117907923 TGAGCGGCGGCGCCGGGCGAGGG + Intronic
1018264957 6:162014393-162014415 TCTGCAGAGGCGCCTGAAGAGGG - Intronic
1024046232 7:45587468-45587490 TCAGGGGCAGGGCCTGATGAAGG + Intronic
1033099696 7:138460115-138460137 ATAGCGGCCGCGCCTGGCGAGGG - Intergenic
1038632907 8:29262855-29262877 TCAGCGGCGGGGCGCGAGGAGGG - Intronic
1039903191 8:41767377-41767399 TCAGCGCGGGCGCCGGACGATGG - Intronic
1053135276 9:35646922-35646944 GCAGCGCCGCCGCCTGGCGAGGG - Intergenic
1053181223 9:35972169-35972191 ACATCGGCGGCGCCTGCCGGCGG - Intergenic
1055090863 9:72364381-72364403 TCCGCGGCGGCGCCCGGCGTGGG - Intronic
1057146919 9:92764793-92764815 GCAGCGGCGGCGGCTGAGGAGGG - Exonic
1058717842 9:107738531-107738553 TCAGCGGCGGCTGCTGGGGAAGG + Intergenic
1062597079 9:137304298-137304320 TCGGCAGCGGCCCCTGGCGAGGG + Intergenic
1186638179 X:11427923-11427945 TCAGCGGCGGCGGCCGCCGGAGG - Intronic