ID: 937950999

View in Genome Browser
Species Human (GRCh38)
Location 2:127387914-127387936
Sequence CTCAGCGGCGGCGCCTGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937950999_937951004 -9 Left 937950999 2:127387914-127387936 CCTCGTCAGGCGCCGCCGCTGAG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 937951004 2:127387928-127387950 GCCGCTGAGGGCAGGCAGCCCGG 0: 1
1: 0
2: 2
3: 50
4: 396
937950999_937951010 21 Left 937950999 2:127387914-127387936 CCTCGTCAGGCGCCGCCGCTGAG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 937951010 2:127387958-127387980 TACACACGGACCCGTGACGTCGG No data
937950999_937951006 7 Left 937950999 2:127387914-127387936 CCTCGTCAGGCGCCGCCGCTGAG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data
937950999_937951011 22 Left 937950999 2:127387914-127387936 CCTCGTCAGGCGCCGCCGCTGAG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 937951011 2:127387959-127387981 ACACACGGACCCGTGACGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937950999 Original CRISPR CTCAGCGGCGGCGCCTGACG AGG (reversed) Intronic
900221422 1:1511523-1511545 CTCCGGGGCGGCGCCTGCCCGGG + Intergenic
902994487 1:20213105-20213127 CACAGCGGAGGCGCCGGAGGCGG + Intergenic
903738173 1:25543566-25543588 CTCCGCCGCGGCGTCCGACGGGG - Exonic
904673001 1:32180005-32180027 CTCAGGGCCGGAGACTGACGTGG - Intronic
905179265 1:36156366-36156388 CTCAGCGGCGGCGGCGGCGGCGG - Exonic
906639596 1:47433714-47433736 CTCCGCGCCAGCGCCTGAAGTGG + Intergenic
922208182 1:223467172-223467194 CTCAGGGTGGGCTCCTGACGGGG - Intergenic
922234418 1:223712521-223712543 CGCAGCGGCGGCGCCCGCAGTGG + Exonic
923652514 1:235887407-235887429 CTCAACGGCAGGGCCTGACATGG - Intergenic
1070763829 10:79045042-79045064 CTCAGCTGCAGAGCCTGCCGTGG - Intergenic
1071202059 10:83230048-83230070 CTCAGCAGAGGCGCCTTAAGAGG + Intergenic
1074586053 10:114768363-114768385 CTCTGCCGCGGCGCCGGGCGGGG + Intergenic
1076312017 10:129515263-129515285 CGCAGCTGCTGCTCCTGACGGGG - Intronic
1076736530 10:132461581-132461603 CTCAGCTGCCACGCCTGGCGTGG - Intergenic
1077038604 11:507381-507403 CGCAGCGGCGGGGCCTGGTGGGG + Intergenic
1079163194 11:18013047-18013069 CACGGGGGCGGCGCCTGCCGGGG + Exonic
1081872470 11:46389717-46389739 CTCTGGGGCGGCGTCCGACGGGG - Intergenic
1085266654 11:75241446-75241468 CTGGGCGGCGGCGCCTTCCGCGG + Exonic
1088172967 11:107018276-107018298 CTCGGCGGCGGCGCCGGGCTGGG + Exonic
1091473947 12:753564-753586 CTCTGCGGCGCCGCCAGACATGG - Exonic
1091682773 12:2538988-2539010 TTCAGCGACGTCGCCTGATGGGG + Intronic
1092204369 12:6606622-6606644 CTCCGTGGGGGCGCCTGCCGGGG - Intronic
1097850263 12:64404463-64404485 CTCAGCGGCGGCGGCGGCTGCGG + Exonic
1103381279 12:120496082-120496104 CTAGGCGGCGGCGGCTGGCGTGG + Intronic
1106157459 13:27171666-27171688 CACAGCGGCGGCGGCGGGCGGGG + Exonic
1113767174 13:112888787-112888809 CTCAGTGGCGGGTCCTGAGGTGG + Intergenic
1121234708 14:92383780-92383802 CTCAGAGGAGGAGGCTGACGAGG - Intronic
1122296451 14:100708913-100708935 CTGTGCGGCGGCCCCTGACTTGG + Intergenic
1122666622 14:103334454-103334476 CTCGGCGGCGGCACCTGGCCCGG + Exonic
1125500563 15:40238315-40238337 ATCAGAGGTGGCGCCTGAAGTGG + Intergenic
1125674199 15:41493902-41493924 CTCAGCGGCGGCGCCGGCACTGG + Exonic
1125960668 15:43827037-43827059 CTCAGCCGCCGCGCCCGACCTGG - Exonic
1129503263 15:76059966-76059988 CTCTGCAGCGGCGCCGGCCGCGG - Exonic
1132479756 16:161046-161068 CTCAGGGGAGTCGCCTGACCCGG + Intronic
1136926696 16:34381305-34381327 CTCAGGGGAGGCGGCTGAGGCGG - Intergenic
1136977878 16:35030502-35030524 CTCAGGGGAGGCGGCTGAGGCGG + Intergenic
1139664892 16:68448452-68448474 CGCAGCGGCGGCGGCTCTCGCGG + Exonic
1141971967 16:87491001-87491023 CTCACCGGCGGCTTCTGGCGTGG + Intronic
1146398659 17:32487296-32487318 CGCAGCGGCGGCGGCGGGCGGGG + Intronic
1147659144 17:42107915-42107937 GTCAGGGGCGGGGCCTGCCGGGG - Intronic
1152924067 17:83079614-83079636 CTCGGCGGCGGCGGCGGGCGCGG + Intergenic
1161707265 19:5828025-5828047 GCCAGCGGCGGCGCCTGCGGCGG + Exonic
1163403440 19:17108193-17108215 CTCAGCAGCGGGGGCTGGCGAGG + Intronic
1163720489 19:18896139-18896161 CCCAGCTGCGGCGCGTGACGCGG - Intronic
1164413144 19:28022199-28022221 CTCAGCAGAGGCCCCTGATGAGG - Intergenic
1165993978 19:39831944-39831966 CTCAGCGGCGGTGGCAGCCGAGG - Exonic
1166386915 19:42387495-42387517 CTCAGGGGCGGGGCCAGCCGGGG + Intronic
1167745337 19:51347517-51347539 CCCAGCGGAGGGGCCTCACGGGG - Intronic
1167891288 19:52541788-52541810 CTCAGGGGCGACGCCTGCAGGGG - Intronic
1168307347 19:55442729-55442751 CGCACCTGCGGCGCCTGACCGGG - Exonic
927714463 2:25342652-25342674 CTCCGCGGCGGCACCTGGCTGGG - Intergenic
928317877 2:30259745-30259767 CTCAGCGGTGGAGCCTGCTGGGG + Exonic
929126605 2:38528229-38528251 CACAGCGGCGGCGGCCGGCGGGG - Intergenic
935709238 2:105882523-105882545 CTCAGTGGCGCTGCCTGCCGTGG - Intronic
937950999 2:127387914-127387936 CTCAGCGGCGGCGCCTGACGAGG - Intronic
940984206 2:160036635-160036657 CTCAGCAGAGGCACCTGAAGAGG - Intronic
944553186 2:200864276-200864298 GGAAGCGGCGCCGCCTGACGCGG - Exonic
945431724 2:209772233-209772255 CTCAGCGGCGGCGGCGGCAGCGG - Intronic
1175266957 20:57709193-57709215 CTCAGCGGCGGCGCACGGCGCGG - Intronic
1183370203 22:37427739-37427761 TGCAGCGGCGGCGCCAGGCGCGG - Intergenic
1183483779 22:38078559-38078581 CTCAGTGCCTGGGCCTGACGGGG + Exonic
1184361911 22:44024137-44024159 TTGAGCGGCGGCGCGGGACGGGG + Intronic
1184787103 22:46677221-46677243 CTCAGCGGCAGCGTCTGGCGGGG + Exonic
952815212 3:37441781-37441803 CTCTGAGGCGGCTCCTGACATGG + Intergenic
954540655 3:51391340-51391362 CACAGCGGCGGCGGCGGAGGCGG - Exonic
960055232 3:113272401-113272423 CTCAGCGGTGGAGCCTGGAGGGG - Exonic
961012907 3:123448110-123448132 CTCGGCGGCGGCGGCTGCCTCGG - Exonic
967596294 3:191329579-191329601 CGCAGCAGCAGCGCCGGACGCGG - Exonic
981006100 4:139876813-139876835 CTCAGAGGCGTTGCCTGAAGTGG + Intronic
982712289 4:158769266-158769288 CTCCGCGGCGGCGTCTGCCCAGG + Exonic
983238669 4:165207569-165207591 CACAGCGTCGGCGCCGGCCGGGG + Intronic
988564911 5:32312975-32312997 GTCAGCGGCGGAGCCGGATGCGG - Exonic
990308732 5:54518280-54518302 CTCGGAGGCGGCGCCTGCTGTGG - Exonic
997974879 5:138435363-138435385 CTCAGCAGCAGCGCCTGCCCAGG + Intronic
999727199 5:154446534-154446556 CTCCGCGGCCGCGCTTGCCGCGG - Exonic
1001506378 5:172283734-172283756 CTCGGCGGTGGCGCCGGAGGAGG - Exonic
1006071049 6:31498246-31498268 CTCACCAGCGGCGGCTGCCGGGG - Exonic
1007784221 6:44270838-44270860 GGCAGCGGCGGCGGCGGACGAGG + Exonic
1014137730 6:117907900-117907922 GTGAGCGGCGGCGCCGGGCGAGG + Intronic
1018264958 6:162014394-162014416 CTCTGCAGAGGCGCCTGAAGAGG - Intronic
1019603860 7:1898820-1898842 CTCAGCACCGGCTCCTCACGCGG - Intronic
1019765133 7:2844275-2844297 TGCAGCGGCGGCGGCGGACGCGG - Exonic
1022106287 7:27199921-27199943 TGCAGCGGCGGCGGCTGCCGGGG - Exonic
1024459489 7:49645367-49645389 CTCAGCAGAGGCCCCTGAAGAGG + Intergenic
1025697971 7:63789869-63789891 GGCAGCGGCGGCGGCTGAGGCGG + Intergenic
1038147775 8:24914043-24914065 CTCAACGGCGGCTCCGGACCCGG + Exonic
1042785095 8:72537381-72537403 CGCAGCGGCGGCGGCGGCCGCGG - Exonic
1051206373 9:14693312-14693334 CTGGGCGGCGGCGCCGGAGGAGG - Exonic
1053135277 9:35646923-35646945 CGCAGCGCCGCCGCCTGGCGAGG - Intergenic
1055090864 9:72364382-72364404 CTCCGCGGCGGCGCCCGGCGTGG - Intronic
1057146920 9:92764794-92764816 GGCAGCGGCGGCGGCTGAGGAGG - Exonic
1059375225 9:113876151-113876173 CTCGGCGGCAGCGGCTGCCGCGG + Intergenic
1060389889 9:123268524-123268546 CCCAGCGGCGGCGGCTGCGGCGG + Intronic
1061453550 9:130681757-130681779 CTCCGCGGCGGCGCCGGGCCGGG - Exonic
1061614783 9:131772691-131772713 GTCGGCGGCGGCTCCTGACATGG - Intergenic
1062392058 9:136337789-136337811 CGCAGCCCCGGGGCCTGACGTGG - Intronic