ID: 937951003

View in Genome Browser
Species Human (GRCh38)
Location 2:127387926-127387948
Sequence GGGCTGCCTGCCCTCAGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937951003_937951010 9 Left 937951003 2:127387926-127387948 CCGCCGCTGAGGGCAGGCAGCCC 0: 1
1: 0
2: 3
3: 21
4: 239
Right 937951010 2:127387958-127387980 TACACACGGACCCGTGACGTCGG No data
937951003_937951006 -5 Left 937951003 2:127387926-127387948 CCGCCGCTGAGGGCAGGCAGCCC 0: 1
1: 0
2: 3
3: 21
4: 239
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data
937951003_937951011 10 Left 937951003 2:127387926-127387948 CCGCCGCTGAGGGCAGGCAGCCC 0: 1
1: 0
2: 3
3: 21
4: 239
Right 937951011 2:127387959-127387981 ACACACGGACCCGTGACGTCGGG No data
937951003_937951014 20 Left 937951003 2:127387926-127387948 CCGCCGCTGAGGGCAGGCAGCCC 0: 1
1: 0
2: 3
3: 21
4: 239
Right 937951014 2:127387969-127387991 CCGTGACGTCGGGCGTAGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937951003 Original CRISPR GGGCTGCCTGCCCTCAGCGG CGG (reversed) Intronic
900206260 1:1433158-1433180 GGGCGTCCTGCCCTCAGCTCGGG + Intergenic
900285742 1:1899550-1899572 AGGCAGCCTGACCTCAGCGAGGG - Intergenic
900317984 1:2068963-2068985 GGGCAGCCTCCCCTCAGAGTTGG + Intronic
900479431 1:2890949-2890971 GGGCTGTCTTCCCTCTGTGGGGG + Intergenic
902580578 1:17405060-17405082 GGGCTCCCTGTCCTCAGCCAGGG + Intergenic
902940868 1:19799655-19799677 GCGCTGCCTGCCCTAAGCCCAGG - Intronic
903033854 1:20481838-20481860 GGGCCCCCTGTCCTCAGAGGCGG - Intergenic
903036958 1:20499248-20499270 GGGATGCCTGCCCCCTGGGGAGG - Intergenic
903658540 1:24963399-24963421 GTGCTGCCTTTCCTCAGCCGAGG - Intronic
903779691 1:25813362-25813384 GGGGTCCCTGCCCTCAAAGGGGG + Intronic
905449123 1:38046062-38046084 GGGCGGCCTGCACGCGGCGGCGG - Exonic
905791347 1:40791399-40791421 GGGCTGCCTGCCCCCAGTGGAGG + Intronic
905912067 1:41662083-41662105 GGGCTGCCAGGCCGCGGCGGGGG + Intronic
906521510 1:46469588-46469610 GGGCAGCCTGCCCTGTGGGGAGG + Intergenic
908524930 1:64978599-64978621 GGGCTCACTGGCCTCAGAGGAGG - Intergenic
910546294 1:88422985-88423007 GGGCAGGCTACCCTCAGTGGTGG - Intergenic
910582866 1:88847764-88847786 AGGCAGCCTGCCCTCATCTGAGG - Intergenic
912456788 1:109803439-109803461 GGGCTGCCTGGCAGCAGCTGTGG - Intergenic
915489825 1:156244866-156244888 GGGCCTCCTGCCCACAGCCGTGG + Exonic
915769003 1:158398756-158398778 GGCCTTCTTGCCCTCAGCTGAGG + Exonic
1062835019 10:629672-629694 GGGCTTCCTTCCCCCAGCGCGGG - Intronic
1062913741 10:1231528-1231550 GGGCTCCCTTCCCTCTGGGGAGG + Intronic
1064634158 10:17346624-17346646 GGGCTGCCTGGGCTCAGCTGGGG - Intronic
1064941003 10:20735432-20735454 GGGCTGCCTCCCTTCACTGGGGG - Intergenic
1065889227 10:30106922-30106944 GGGCTGCCTGCACCCAGCCGTGG - Intronic
1069592930 10:69652970-69652992 GGCCTGGGTGCCCTCAGCAGGGG + Intergenic
1069813693 10:71180217-71180239 GACCAGCCTGCCCTCAGCGTGGG - Intergenic
1070153517 10:73819557-73819579 GGGCTGCATGCCTGCAGAGGGGG + Exonic
1070590949 10:77800563-77800585 GGGTTCTCAGCCCTCAGCGGCGG - Intronic
1070598738 10:77851060-77851082 AGGCCGCCTGCCCTCAGGTGGGG + Intronic
1073488889 10:103839629-103839651 GGGCTGCGTGGCCTCTGGGGAGG - Intronic
1075731527 10:124639355-124639377 GGGCTGCATGCCCACTGCTGAGG - Intronic
1076167229 10:128292353-128292375 GGGCTGTGTGGCCTCAGGGGAGG + Intergenic
1076189154 10:128470572-128470594 GGGGTGCCTGCGCTCAGCACTGG - Intergenic
1076561195 10:131365717-131365739 GGTCTGGCTTCCCTCAGAGGAGG - Intergenic
1076608386 10:131704121-131704143 GTGCTGCCAGCCCTCGGGGGTGG + Intergenic
1076770414 10:132659786-132659808 TGGCTGCCTGCCCTGGGAGGTGG + Intronic
1076829004 10:132985037-132985059 GGGCCGCCAGCCCTCAGCCTGGG - Intergenic
1077324795 11:1959033-1959055 GGGCTGCCAGTCCTCGGCGGGGG + Intronic
1077530210 11:3091472-3091494 AGGCTGACTGACCTCAGCAGGGG + Intronic
1077708839 11:4515464-4515486 GGGCTGGCTGCCCTCCTCCGGGG - Intergenic
1077802161 11:5550649-5550671 AGGGTGCCTGCACTCAGCCGGGG + Intronic
1078821445 11:14887007-14887029 GGACTGCCTGCCATAAGCAGTGG + Intronic
1080428453 11:32177100-32177122 GGGCTGCCTGCCCAGGGAGGAGG + Intergenic
1082761143 11:57128004-57128026 GGGCTTTGTGCCCTCAGGGGTGG + Intergenic
1083214709 11:61211116-61211138 GGCCTGGCAGCCCTCAGCGCAGG - Exonic
1083217593 11:61229945-61229967 GGCCTGGCAGCCCTCAGCGCAGG - Exonic
1083712591 11:64558427-64558449 GAGCTGCCGGGCCTCAGTGGAGG + Intronic
1083886706 11:65576603-65576625 GGGCAGCCTTCCCTGCGCGGGGG + Intronic
1084320422 11:68370391-68370413 AGGCTGCCTGCGCTCACAGGGGG + Intronic
1085758353 11:79220134-79220156 GGGCTGCCTTCCCTAAACAGGGG - Intronic
1088349647 11:108871354-108871376 GGGCATCCTGCCCTCTGCTGGGG + Intronic
1090326129 11:125887810-125887832 TGGCTGCCGGCCCACTGCGGCGG + Intronic
1091357186 11:134946166-134946188 GGTATTCCTGCCCTCAGCTGGGG - Intergenic
1202807775 11_KI270721v1_random:14210-14232 GGGCTGCCAGTCCTCGGCGGGGG + Intergenic
1092147393 12:6224036-6224058 GAGCTGCCTGCCCTAAGGTGCGG + Intronic
1096228053 12:49881918-49881940 GGGCGGCCTGCCCTCAAAGATGG + Intronic
1101968525 12:109296635-109296657 GGGCTGCCTGCACCCAGCAGGGG - Intronic
1102051355 12:109864331-109864353 GGGCTGCCTGCAATTAGCAGTGG + Intronic
1102947968 12:117006502-117006524 GGCCCGCCTGCCCACGGCGGTGG + Intronic
1103723865 12:122988396-122988418 GGGCTTCCTGCCCTGGGAGGAGG + Intronic
1103807523 12:123584821-123584843 GGGCTAGCTGCCCGCAGCTGAGG + Intronic
1104221745 12:126791224-126791246 GGTCTGCCTGCCCTCGGCGGTGG + Intergenic
1104765837 12:131329699-131329721 GGGCTCCCGGCCCTCAGCGCGGG - Intergenic
1104813429 12:131632163-131632185 GGGCTCCCGGCCCTCAGCGCGGG + Intergenic
1104952420 12:132447530-132447552 GCTCCGCCTGCCCTCAGCGGGGG - Intergenic
1104991268 12:132625107-132625129 GGGCTGGCTGCACACAGCAGGGG - Intronic
1113793046 13:113040857-113040879 GGGCTGTCTGCCCACATGGGTGG + Intronic
1114409197 14:22484873-22484895 CAGATGCCTGCCCTCAGCTGAGG - Intergenic
1114646773 14:24260375-24260397 GGGCTTCCTGCCCTCGGATGTGG - Intronic
1118322810 14:64763275-64763297 GGTCTGCCTGCCCACTGCCGAGG + Intronic
1118616979 14:67580661-67580683 GGGCTGCCTAGCCTCTGGGGAGG + Intronic
1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG + Intronic
1120905720 14:89619274-89619296 GAGCTGCCTGCCCTCGGTGCGGG - Intergenic
1121494195 14:94380693-94380715 GCGCTGCCTGAACTCAGTGGTGG + Intronic
1122145806 14:99688282-99688304 TGGCCGCCTGCCCGCAGTGGAGG - Intronic
1122168738 14:99853280-99853302 GGGCTGCATCCCCTGAGTGGAGG + Intronic
1122402501 14:101475623-101475645 GTCCTGCCTGCCCTGAACGGGGG - Intergenic
1124644403 15:31426822-31426844 GGGGTGCCTGCCCACAGTGAGGG - Intronic
1127532703 15:59860274-59860296 AGGCTGCCTGGCCTCAGCACTGG - Intergenic
1127868659 15:63051996-63052018 GGGGTGCATGCCCTTAGAGGAGG + Intronic
1128982377 15:72197221-72197243 GAGCTGCCTCCCCGCAGCCGCGG + Intronic
1129200355 15:73994895-73994917 GGGCTGGCGGCCTTCAGAGGGGG - Exonic
1129787572 15:78319883-78319905 GGGCTGCCTGTCGTCAGGGATGG - Intergenic
1130348012 15:83066885-83066907 GCGCTGCGGGCCCCCAGCGGCGG + Exonic
1130653478 15:85775720-85775742 GTGCTGCCAGCCCTCAGGAGGGG - Intronic
1130655926 15:85792148-85792170 GGGCTGACTTCCATCAGCTGGGG + Intronic
1132137446 15:99355935-99355957 GGGCTGCCTGCCCCCAGTATCGG + Intronic
1132384437 15:101390191-101390213 GCTCTGCCTGCCCTCCTCGGAGG + Intronic
1202971186 15_KI270727v1_random:240642-240664 GTGCTGCCTGCACCCAGGGGTGG - Intergenic
1132610515 16:813697-813719 GGGCTGGCCGTCCTCCGCGGCGG - Exonic
1132793806 16:1708319-1708341 GGGCTGCCCTCGCTCAGCTGTGG + Intronic
1133221752 16:4321912-4321934 GGACAGCCTGCCTCCAGCGGGGG + Intronic
1134135236 16:11673031-11673053 GGGGTGCCTGCCCTCCCCTGGGG - Intronic
1135209595 16:20513041-20513063 AGGCTGCCTGCCCACAGAAGAGG - Intergenic
1135976333 16:27110826-27110848 GAGCTCCCTGCCCACAGCTGAGG - Intergenic
1139955318 16:70690388-70690410 GGGCTGGCTGGCCTCAGCCTCGG - Intronic
1141253407 16:82379574-82379596 CGGCTGCCTGGCCTCCGAGGAGG - Intergenic
1141920154 16:87130231-87130253 GAGCTCCCTGCCTTCAGCGCGGG - Intronic
1142229857 16:88895103-88895125 GGGCTGCGTCCCCACAGCTGGGG + Intronic
1142863584 17:2777509-2777531 GGGGTGCCGGCCCTGAGTGGGGG + Intronic
1143499623 17:7330964-7330986 GGGCTGGCTGCCCGCAGAGCTGG - Intergenic
1143548480 17:7614508-7614530 GGGCGGCCTGGCCTCTGGGGGGG - Exonic
1144631157 17:16873202-16873224 TGGCTGCCTGCCCTGTGCAGAGG - Intergenic
1144649415 17:16997906-16997928 TGGCTGCCTGCCCTGTGCAGAGG + Intergenic
1146950122 17:36899923-36899945 GGGCTGCCAGCCTTCAGCCCAGG + Intergenic
1147469800 17:40648402-40648424 GGGCTTCCTGCCCTCACGGCGGG + Exonic
1147819253 17:43231929-43231951 GGGGTCCCAGCCCTCAGCGATGG - Intergenic
1147819842 17:43234960-43234982 GGGGTCCCAGCCCTCAGCGATGG - Intergenic
1147821154 17:43242358-43242380 GGGGTCCCAGCCCTCAGCGATGG - Intergenic
1147821959 17:43246847-43246869 GGGGTCCCAGCCCTCAGCGATGG - Intergenic
1147825562 17:43267806-43267828 GGGGTCCCAGCCCTCAGCGATGG - Intergenic
1147826693 17:43274273-43274295 GGGGTCCCAGCCCTCAGCGATGG - Intergenic
1147827582 17:43279151-43279173 GGGGTCCCAGCCCTCAGCGATGG - Intergenic
1147828689 17:43285312-43285334 GGGGTCCCAGCCCTCAGCGATGG - Intergenic
1147830877 17:43297585-43297607 GGGGTCCCAGCCCTCAGCGATGG - Intergenic
1147831576 17:43301214-43301236 GGGGTCCCAGCCCTCAGCGATGG - Intergenic
1147840657 17:43369100-43369122 GGGCTCCCTGCCCCCGGAGGGGG + Intergenic
1148786170 17:50147287-50147309 GGGTTCTCTGCCCTCAGCAGAGG + Intronic
1150287942 17:63964410-63964432 GTTCTACCTGCCCTCAGCCGGGG - Intronic
1151456900 17:74231915-74231937 GGGCTGCCACCCCTCTGCTGGGG + Intronic
1151932411 17:77241050-77241072 TGGCTTCATGCCCTCAGCAGCGG - Intergenic
1152120062 17:78413051-78413073 GGGCAGCCTGCCCACACCTGTGG + Intronic
1152148254 17:78582348-78582370 GGGATGCCTGCCCACTGGGGAGG - Intergenic
1152240751 17:79159672-79159694 GGGCTGCATGCCCGCAGCTGGGG + Intronic
1156836183 18:41558053-41558075 TGGCTTCCTGCCCCCAGCAGAGG - Intergenic
1158610963 18:58940470-58940492 GGGCTGCCTGCCTGCAGTAGGGG + Intronic
1160064582 18:75562823-75562845 GGGCTGCCTTCTCTCAGCCCCGG - Intergenic
1160534450 18:79584770-79584792 AGGCTGCCTGCTCCCAGCTGGGG - Intergenic
1160824672 19:1074102-1074124 AGGCTGCCTGCCCGCCGAGGAGG + Exonic
1160989373 19:1854277-1854299 GGTCTGCCTGACCTCAGAGGTGG - Exonic
1160992564 19:1865705-1865727 GGGCTGTGTGCCCTCACCTGGGG - Intergenic
1161000361 19:1907727-1907749 GGGCTGCCTGCCCTCCTGAGGGG + Intronic
1161352781 19:3803257-3803279 AGGCCGCCTGCCCTCCGGGGAGG + Intergenic
1163408073 19:17136026-17136048 GGGATGCCTGTCCTCAGGGGTGG - Intronic
1163715326 19:18869592-18869614 GGGTGGGCTGCCCTCGGCGGGGG + Intronic
1164934179 19:32198338-32198360 CAGCTGCCCTCCCTCAGCGGGGG + Intergenic
1165014565 19:32871150-32871172 GGGCTGTCTGGCCCCAGCGGGGG - Intergenic
1165819153 19:38663591-38663613 CGGCAACCTGCCCGCAGCGGGGG - Intronic
1165852792 19:38860011-38860033 GGCCTGCCTGCAGTCACCGGAGG - Intergenic
1166677417 19:44748484-44748506 GGGCAGCCAGGCCTCGGCGGGGG - Intronic
1167134913 19:47610153-47610175 GGCCTGGCTGCCCTCCGCAGGGG - Intronic
1168144940 19:54415567-54415589 GGGCTACCGGCCCTCAGCTTGGG + Exonic
928459345 2:31456346-31456368 GGGCTCCCTTCCCTTAGCTGTGG + Intergenic
931428188 2:62189923-62189945 GGGCTGCCTGTCCACCTCGGAGG + Intergenic
931869907 2:66446063-66446085 GGGCTTCCCGGCCTCAGCGTGGG + Intronic
934917580 2:98312431-98312453 GGGCGGCCTTACCTCCGCGGAGG - Exonic
935541598 2:104354683-104354705 GGGCTGGCAGCCCTGAGCTGTGG - Intergenic
936518309 2:113196402-113196424 TGGCTGCCTGTCCTCAACGCGGG - Intronic
936528768 2:113260530-113260552 TGGTTTCCTGCCCTCAGCAGGGG - Intronic
937951003 2:127387926-127387948 GGGCTGCCTGCCCTCAGCGGCGG - Intronic
938069334 2:128300261-128300283 GGGCTGCAGGCCCTCTCCGGAGG - Intronic
938341928 2:130541525-130541547 GGGTTCCCTGCCCTCTGAGGAGG - Intronic
938347904 2:130579186-130579208 GGGTTCCCTGCCCTCTGAGGAGG + Intronic
940515238 2:154676215-154676237 GGGCTGCCTGCTTTCACCGTTGG + Intergenic
949042477 2:241855677-241855699 AGGCTGCCTGCCCCGGGCGGAGG + Intronic
1172490209 20:35330485-35330507 GGGCTTCCTGCCATCAGCCAGGG + Intronic
1172620540 20:36315823-36315845 TGGCTGCCTGCCCACTGCTGAGG + Intronic
1172844983 20:37924794-37924816 GAGCTGCCTGCTTTCAGTGGGGG + Intronic
1174334728 20:49851478-49851500 AGGCTGTCTGCTCTCAGAGGGGG - Intronic
1174483328 20:50845872-50845894 GGGCAGCCTGCCCTCTCTGGGGG - Intronic
1179344623 21:40545384-40545406 GGGCTGCCTATCCCCAGTGGAGG - Intronic
1179728571 21:43354432-43354454 GGGATGCCTGCCCTGACCAGAGG - Intergenic
1180908609 22:19432478-19432500 GGTCTGCCGGACCTCAGCAGGGG + Exonic
1181042793 22:20200543-20200565 GTGATCCCTGCCCTCAGTGGAGG + Intergenic
1181107588 22:20584197-20584219 GGGCTGCCTGCCTTCAACTCTGG + Intronic
1181571119 22:23768209-23768231 CCGCTCCCTGCCCTCTGCGGTGG - Exonic
1181696385 22:24594863-24594885 GGGCTGCCTGCTCTGGGCAGGGG - Intronic
1181804327 22:25365965-25365987 AGGCTGCCTTCCCATAGCGGCGG - Intronic
1183828161 22:40404540-40404562 CGGCTCCCTTCCCTCAGCTGTGG + Exonic
1184372845 22:44093538-44093560 GGGCTGCCTTCCCTCTGCCGGGG - Intronic
1184405968 22:44301030-44301052 GGCTTTCCTGCCCACAGCGGGGG + Intronic
1184758408 22:46530827-46530849 GGGCTGCCAGCTTTCAGCAGAGG - Intronic
1185295050 22:50049071-50049093 GGCCTGGCTGCCCCCAGGGGTGG - Intronic
1185394644 22:50580548-50580570 GTCCTGCCTGCCCTCACCTGAGG + Exonic
950164162 3:10780993-10781015 GGGCAGCCTGCCAGCAGCAGTGG + Intergenic
950262615 3:11553736-11553758 AGGCTGCCTCCCCTCAGCCTGGG + Intronic
950831563 3:15879868-15879890 GGGCTGCCTGCCCCCCAGGGTGG - Intergenic
951640362 3:24829316-24829338 CCGCTGTCTGCTCTCAGCGGCGG + Intergenic
954235433 3:49253503-49253525 GACCTGCCTCCCCTCAGCTGTGG + Intronic
955032818 3:55237455-55237477 TGGCTGCCTGGCCTCTGCGGAGG - Intergenic
955298742 3:57757028-57757050 GGGCGGCCTCCGCTCAGCAGGGG + Exonic
955395881 3:58556895-58556917 GGGCTGCCTGCCGGCAGGGAAGG + Intergenic
962198014 3:133380104-133380126 GGGCAGCCTGCCCTCGAGGGCGG - Exonic
962417120 3:135193264-135193286 GGGCCACCTGCCCTCTGAGGAGG + Intronic
964819542 3:160755407-160755429 GGGCTGCGAGCCCGCACCGGCGG + Intergenic
967137681 3:186526371-186526393 TGCCTGGCTGCCCGCAGCGGTGG + Intergenic
967992003 3:195138474-195138496 GGGCCGCCTGCACCCAGCTGTGG - Intronic
968046716 3:195628186-195628208 GGGCCACCTGCCGTCATCGGGGG - Intergenic
968225619 3:196970127-196970149 CGGCTGCCGACCCTCGGCGGCGG - Intergenic
968625122 4:1623528-1623550 GGGCTGCCCGCCTTCCCCGGCGG + Intronic
968685927 4:1958548-1958570 GGGCTGCCTGCGCTCAGAGCTGG + Intronic
969321940 4:6417701-6417723 AGCCTGCCTGCCCTCACTGGAGG - Intronic
969690820 4:8703195-8703217 GGGCTGTGTGTCCTCAGAGGAGG + Intergenic
970823864 4:20251744-20251766 GGGCTGCCAGCGCTGGGCGGAGG - Intergenic
976512902 4:85931317-85931339 GGGCTGACCGTCCTCAGAGGAGG + Intronic
984708221 4:182863226-182863248 AGGCTGCCTGACCCCAGCGTGGG + Intergenic
985540073 5:483704-483726 GGGCTGCCTGCCAGCAGGGAGGG + Intronic
985703912 5:1389751-1389773 GGGCTGCCAGCCATCACCAGGGG - Intergenic
985988342 5:3535860-3535882 GCGGTGCCTGCCCTCCACGGCGG + Intergenic
988330176 5:29827453-29827475 CAGCTGCCTGCCATCAGCAGGGG - Intergenic
988409981 5:30874700-30874722 TGGCTCTCTGCCTTCAGCGGAGG - Intergenic
992093340 5:73338901-73338923 GGGCTCCCTGAACTGAGCGGAGG + Intergenic
992192253 5:74304734-74304756 TGGCTGTCTGCCCTCAGCAGAGG + Intergenic
997408468 5:133671145-133671167 AGGCTGTCTGCCATCAGCTGGGG - Intergenic
997579808 5:135010168-135010190 GTGCTGCCTGTCCTCAATGGTGG + Intronic
998231386 5:140363489-140363511 GCGGTGCCTGTCCTCAGCCGAGG - Exonic
999372627 5:151065035-151065057 GGGCAGCGTGCCCTCAGGAGAGG - Exonic
1001837695 5:174845642-174845664 GGGCTGCCAGTCCTCTGCTGGGG + Intergenic
1002139268 5:177128903-177128925 GGGCTGCCTGGTCTCAGATGTGG + Intergenic
1002186837 5:177458584-177458606 GGGCTGCCTGGCCCCCGGGGAGG + Exonic
1002401202 5:178992397-178992419 GGGCTGCAGGCCCTCTGCTGGGG - Intronic
1002498516 5:179632375-179632397 GTGCTGCCTGGCCGCGGCGGGGG - Intronic
1003555983 6:7140946-7140968 CGGGTGCCTTCCCTCAGAGGCGG + Intronic
1005296286 6:24430540-24430562 GGGCTGCCTTCCATCAGCTCAGG - Intronic
1007421099 6:41720292-41720314 GGGCTGCCTGCACTCAAAGCTGG + Intronic
1008458390 6:51738833-51738855 GGAGTGCCTGCCCTGAGCAGAGG - Intronic
1011449019 6:87473184-87473206 GGGCAGCCTGCCTTCCGCTGCGG + Intronic
1012912746 6:105136659-105136681 GGGCTGCCTGACCTGAGCGGCGG + Intronic
1017527702 6:155256613-155256635 GTCCTGCCTGCCCTCAGCCGTGG - Exonic
1018125583 6:160679310-160679332 AGGCAGCCTGCGCTCCGCGGAGG - Intergenic
1019520873 7:1459929-1459951 GGGGTCTCGGCCCTCAGCGGCGG - Intergenic
1019537255 7:1535750-1535772 GGGCTGCCTGCCCTGCCGGGGGG + Intronic
1019620483 7:1989483-1989505 GGGCTGGGAGCCCTCGGCGGCGG + Intronic
1019731169 7:2630437-2630459 GGCCTGCCTGCCCACAGAGCTGG + Intergenic
1020011742 7:4809120-4809142 GCGCTTCCTGGCCTCAGCGTGGG + Intronic
1021968432 7:25944932-25944954 GGGCTGCCTGCCAGGAGCTGGGG - Intergenic
1022020347 7:26394346-26394368 GGGCTGCCTTTCCTCAGCAGCGG + Intergenic
1027187236 7:75979811-75979833 GGGCAGCCGGCACTCAGGGGAGG - Intronic
1028985572 7:97006190-97006212 GCACTGCCTGCACTCGGCGGCGG + Exonic
1029456194 7:100673756-100673778 GCGCTGCCTCCCCAGAGCGGAGG - Exonic
1029491796 7:100874803-100874825 GGGCCTCCTGACCTCACCGGGGG - Intergenic
1033154273 7:138943340-138943362 GGGCTGTCTGCCCCCAGCGCCGG + Intronic
1033324751 7:140368160-140368182 GGGCTTCCAGTCCTCAGAGGTGG - Intronic
1034980484 7:155472971-155472993 CGGCTCCCTGGCCTCAGCAGGGG + Intergenic
1035032627 7:155871372-155871394 GGGCTCTCTGAGCTCAGCGGCGG + Intergenic
1035041940 7:155935508-155935530 TGGCTGCCTGCCCCCAGCCATGG + Intergenic
1035298431 7:157880585-157880607 GGCCTGCCTGCCCTCAGAGCTGG - Intronic
1035770137 8:2140293-2140315 GGGCTGCCTCCCCACCGGGGCGG + Intronic
1035833923 8:2728015-2728037 GAGCTGCCTCCCCTCAGGGCAGG + Intergenic
1036663691 8:10725623-10725645 GACCTCCCTGCCCTGAGCGGTGG + Exonic
1036668896 8:10766580-10766602 GGGCTTCTTTCCCTCAGCTGGGG + Intronic
1036712839 8:11092929-11092951 GGGCAGGAGGCCCTCAGCGGGGG - Intronic
1038447028 8:27611444-27611466 GGGCTGGCTGCCCTGAGCCACGG + Intronic
1040998179 8:53422696-53422718 GTGCTGCCTGTCCTGAGCTGAGG - Intergenic
1045260942 8:100573771-100573793 GGGCTACCTACCATCAGTGGAGG - Exonic
1049190085 8:141282487-141282509 AGGCGGCGTGCCCTGAGCGGCGG - Intronic
1049303357 8:141883598-141883620 GGGCTGCAGGCCCTCTGCTGAGG + Intergenic
1049423773 8:142528292-142528314 GGGGTCCCTGCGCTCAGCTGAGG - Intronic
1055007503 9:71525390-71525412 GCGCTCCCTGCCCTCAACTGTGG - Intergenic
1056839945 9:89990417-89990439 GGGATGCCCACCCTCAGAGGGGG + Intergenic
1061295910 9:129676663-129676685 GGGTTGCCTGGCCTCAGTGAGGG - Intronic
1062360687 9:136186561-136186583 GGGCTGCCTGCCCCCCTCGGGGG - Intergenic
1062676150 9:137745581-137745603 GGGCTGCCTGTCCTTCGGGGAGG - Intronic
1062733559 9:138122073-138122095 GGGCAGCCGGCCCTCGGGGGAGG + Exonic
1203787235 EBV:134806-134828 GGGCTACCTGGCCTCCCCGGTGG + Intergenic
1186509104 X:10117267-10117289 AAGCTGGCTGCCCTCAGCGTCGG - Exonic
1192123318 X:68476997-68477019 GGGCTGGCTGCATGCAGCGGCGG + Intergenic
1194981697 X:100447962-100447984 TGGCTGCCTGGGCTCAGCTGGGG - Intergenic
1195020675 X:100824147-100824169 GGGTTGCCTGCAATCAGCGTTGG - Exonic
1195884405 X:109624608-109624630 GGGCTGCCTGCCCTCGCCCAGGG - Exonic
1199182822 X:144878594-144878616 TGGCAGCCTGCCCTCACCCGGGG - Intergenic
1200067199 X:153509602-153509624 GGGCTCCTTGCCCTCAGAAGAGG + Intergenic
1200073114 X:153538643-153538665 GGGCGGCCTGCCCGGAGCAGAGG - Intronic