ID: 937951005

View in Genome Browser
Species Human (GRCh38)
Location 2:127387929-127387951
Sequence GCCGGGCTGCCTGCCCTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937951005_937951015 29 Left 937951005 2:127387929-127387951 CCGCTGAGGGCAGGCAGCCCGGC 0: 1
1: 0
2: 3
3: 33
4: 269
Right 937951015 2:127387981-127388003 GCGTAGCGCGGCGCACGTCACGG No data
937951005_937951010 6 Left 937951005 2:127387929-127387951 CCGCTGAGGGCAGGCAGCCCGGC 0: 1
1: 0
2: 3
3: 33
4: 269
Right 937951010 2:127387958-127387980 TACACACGGACCCGTGACGTCGG No data
937951005_937951014 17 Left 937951005 2:127387929-127387951 CCGCTGAGGGCAGGCAGCCCGGC 0: 1
1: 0
2: 3
3: 33
4: 269
Right 937951014 2:127387969-127387991 CCGTGACGTCGGGCGTAGCGCGG No data
937951005_937951006 -8 Left 937951005 2:127387929-127387951 CCGCTGAGGGCAGGCAGCCCGGC 0: 1
1: 0
2: 3
3: 33
4: 269
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data
937951005_937951011 7 Left 937951005 2:127387929-127387951 CCGCTGAGGGCAGGCAGCCCGGC 0: 1
1: 0
2: 3
3: 33
4: 269
Right 937951011 2:127387959-127387981 ACACACGGACCCGTGACGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937951005 Original CRISPR GCCGGGCTGCCTGCCCTCAG CGG (reversed) Intronic
900205138 1:1428219-1428241 GCCCGGCAGGCAGCCCTCAGAGG + Intergenic
900266859 1:1761719-1761741 GCTCGGATGCCTGCACTCAGGGG + Intronic
901162767 1:7192643-7192665 GGCGGGCAGCGTGCACTCAGGGG - Intronic
901163573 1:7198852-7198874 GCGGGGCTCCCTGCCTGCAGAGG - Intronic
901452589 1:9345065-9345087 TCAGGGCTGCCTGGCCTGAGAGG - Intronic
902659506 1:17891407-17891429 GCCGGCCTGGATGCCCTCAAAGG + Intergenic
902690537 1:18107956-18107978 CCCGGGCTGCCTGGCCGCGGCGG + Exonic
902923944 1:19683321-19683343 CCCAGGCTGCCTGCCCTCCGAGG - Exonic
903036960 1:20499251-20499273 GCCGGGATGCCTGCCCCCTGGGG - Intergenic
903153535 1:21429483-21429505 GCCGGGCCGCGTGCCCACCGAGG + Intergenic
905017906 1:34790227-34790249 ACCCAGCTGCCTGCCCTCAAAGG + Intronic
905182366 1:36175240-36175262 GCCAGGCTTCCTGCCCTCTGCGG - Intronic
905749454 1:40449956-40449978 GCCGGGTTGGCTGCGTTCAGGGG - Intergenic
905791346 1:40791396-40791418 AGGGGGCTGCCTGCCCCCAGTGG + Intronic
911128006 1:94359375-94359397 TCCGGGCTGTCTGCCTCCAGGGG + Intergenic
912274483 1:108242040-108242062 GCCCATCTGCCTGCCCCCAGTGG + Intronic
912286784 1:108377818-108377840 GCCCATCTGCCTGCCCCCAGTGG - Intronic
912383222 1:109258709-109258731 GCCGCCCTTCCTGCCCTCTGAGG + Exonic
912861814 1:113220001-113220023 GCCCCTCTGCCTGGCCTCAGAGG - Intergenic
913075188 1:115336181-115336203 ACCGGGATGACTGCCCTGAGTGG + Intronic
914885941 1:151584505-151584527 GCCGGGCCTCCTGTGCTCAGTGG + Intergenic
915020875 1:152777454-152777476 GCCGGGGTCCCTGAGCTCAGAGG + Intronic
915195146 1:154183450-154183472 GCCAGGCTGGCTGCCCACAATGG + Intronic
917805933 1:178613764-178613786 GCAGGGCTCCCAGCCATCAGAGG + Intergenic
921133033 1:212236097-212236119 CCAGCGCTGCCTGCCTTCAGTGG + Intergenic
922571329 1:226636176-226636198 GCCTGGCTGCCTGACCCCAGGGG - Intronic
1063423527 10:5933529-5933551 GGTGGGCTGTCTGCCCTCAGGGG + Intronic
1063463025 10:6226320-6226342 GCCCAGCTGCCTGCCCCCGGAGG + Exonic
1065839360 10:29688250-29688272 GCCTGACTGTCTCCCCTCAGGGG + Intronic
1066997563 10:42578030-42578052 GCCGGTGGGCCTGCCCTGAGGGG + Intronic
1067778031 10:49177027-49177049 GCCCTGCTGCCTGCCGCCAGGGG + Intronic
1069547346 10:69338224-69338246 GCCGGTCTGGCTACCCTCATAGG + Intronic
1070679515 10:78438778-78438800 CCCAGGCTTCATGCCCTCAGAGG - Intergenic
1072426749 10:95336626-95336648 GCCGGGCCGGCTCTCCTCAGGGG + Exonic
1073444881 10:103574675-103574697 GACGGGCTTCCCACCCTCAGGGG + Intronic
1074900092 10:117808897-117808919 GCCGTGGTGCCTGCCCTAAAAGG + Intergenic
1075724711 10:124605331-124605353 GCCAGGTTTCCTGCCCTCGGTGG - Intronic
1076723640 10:132403674-132403696 GCCGGGCAGCCTGCGCTTAACGG - Intronic
1076832032 10:133000338-133000360 GCCGTGCTTCCTGCCCTGCGTGG - Intergenic
1077023184 11:428667-428689 CCCGGGCTGCATGCCCTCCCCGG - Intronic
1077047584 11:553261-553283 CCCGGCCTGCCTGCCCGCTGAGG - Intronic
1077244500 11:1529652-1529674 GCCGGGCTGCACGCCCTGGGAGG + Intergenic
1077244680 11:1530785-1530807 GCTGGGCTGGCAGCCCTCAGGGG - Intergenic
1077362167 11:2145573-2145595 GCCGAGGTGCCTTCCCCCAGGGG + Intronic
1077489169 11:2852651-2852673 CCCCGGCTGTCTGCACTCAGAGG - Intergenic
1078060416 11:8039437-8039459 GCCTGCCTGCCTGCCATCCGGGG + Intronic
1078323088 11:10354505-10354527 GCCAGCCTGCCTCCCCACAGTGG - Intronic
1078514374 11:12009411-12009433 GCCGGGCTGCGGCCCCTCCGCGG - Intronic
1078549420 11:12270009-12270031 GATGGGCTGGCTGCCCTCATGGG - Intergenic
1079114371 11:17631802-17631824 GCCCAGCTCCCTGACCTCAGTGG + Exonic
1080887183 11:36377442-36377464 GCCGGGCTCGCTGCACGCAGGGG + Intronic
1082095424 11:48125928-48125950 GACAGGCTGCCTGACCTCATGGG + Intronic
1082764541 11:57156558-57156580 CCCAGGTTGCCTGCCCTCCGTGG - Intergenic
1083628771 11:64085384-64085406 GGCGGGCTGCCTGCCTTCCGGGG + Intronic
1083730231 11:64648809-64648831 TCAGGGCTGCCTGGCCTCAGTGG - Exonic
1083921092 11:65781591-65781613 GCCGCGCTGGCGGCCCGCAGGGG + Intergenic
1084451988 11:69244499-69244521 GCCGGGCTGCCTGCCTTTATAGG + Intergenic
1084650884 11:70488576-70488598 CCTGGGCTCCCTCCCCTCAGGGG - Intronic
1084708253 11:70828672-70828694 GCCTGGCTGCCTGCCCTGGCTGG + Intronic
1085052656 11:73387761-73387783 GCCGGGCTGCCTGCAGGGAGAGG + Intronic
1085205851 11:74731464-74731486 GCCGGGCTGCCTGCTTCCCGCGG - Intergenic
1085688717 11:78648717-78648739 GCCCAGCTGCCTGCCCCCAGGGG + Intergenic
1088988377 11:114929461-114929483 CCCGGGCTGGCTGGACTCAGGGG - Intergenic
1088994519 11:114985075-114985097 GCCGGGCTGTCTTACCCCAGGGG - Intergenic
1089014553 11:115155633-115155655 GCAGGGCTGCCACCCCTCAAAGG + Intergenic
1089073059 11:115716225-115716247 GCGGGGATGCCTGTCCCCAGGGG - Intergenic
1089749768 11:120642681-120642703 GCCTGGCATCCTGCCTTCAGCGG + Intronic
1090171729 11:124611599-124611621 GCCCTGCTGCCTGACCGCAGGGG + Exonic
1090412347 11:126518000-126518022 GTCAGGCTGCGTGCCCTCTGTGG - Intronic
1091134857 11:133179502-133179524 GCCGCTCTCCCTGGCCTCAGGGG - Intronic
1094470858 12:30799736-30799758 GCCAGGCTCCTTGCCATCAGGGG - Intergenic
1097186613 12:57199643-57199665 GCCGGCCTGCCTTCCTTCTGGGG - Intronic
1101379843 12:104205115-104205137 GCTGGGCGGCCTGGCTTCAGGGG - Intergenic
1102236939 12:111299342-111299364 ACCTGGCTGCCCTCCCTCAGGGG - Intronic
1102688070 12:114739667-114739689 GCTGGGCTGCCTGCCCTAGTAGG + Intergenic
1103852679 12:123943537-123943559 CCAGGGCTGCCTGCCCTCCTTGG + Intronic
1104221744 12:126791221-126791243 CACGGTCTGCCTGCCCTCGGCGG + Intergenic
1104965776 12:132508267-132508289 CCGGGGCTGCCTGCCTCCAGGGG - Exonic
1105821977 13:24087928-24087950 GCTGGGCTGGCTGACCTCAGGGG - Intronic
1112809418 13:103200383-103200405 GCAGGGCTGCATTCCCTCTGGGG + Intergenic
1113778032 13:112960069-112960091 TCCCGGACGCCTGCCCTCAGGGG + Intronic
1118008937 14:61590417-61590439 GCCTGCCTGGCTGGCCTCAGAGG - Intronic
1119070459 14:71577820-71577842 GCAGGGCTGCTTGAGCTCAGAGG - Intronic
1119112334 14:71986786-71986808 GCAGAGCTGCATGCCCTCAGGGG + Intronic
1121337330 14:93085373-93085395 GCCGGCCTGCCTCCCCTGGGTGG - Intronic
1121866351 14:97366178-97366200 GCCCCGCTGCGTGCCCTCAATGG + Intergenic
1122273122 14:100577323-100577345 GCCGGACTGCCTCCCCTTGGAGG - Intronic
1123030414 14:105448809-105448831 GCCGGGCTGCTCGCTCTCTGCGG - Intronic
1124625916 15:31307434-31307456 CCTGGGGTGCCTGCCGTCAGTGG + Intergenic
1129200358 15:73994898-73994920 GCTGGGCTGGCGGCCTTCAGAGG - Exonic
1129227208 15:74176952-74176974 GCCAGCCTGCCTGCCCACAGTGG + Intergenic
1129273017 15:74429280-74429302 GCAGGTCTGGCAGCCCTCAGGGG - Intronic
1130963688 15:88681861-88681883 ACCTGGCTGCCCGCCCTCGGGGG - Intergenic
1202971187 15_KI270727v1_random:240645-240667 GCTGTGCTGCCTGCACCCAGGGG - Intergenic
1132546081 16:534123-534145 GCAGGGCTGCCGGCCTCCAGGGG - Intronic
1132622942 16:876237-876259 GACTGGCTTCCTGCCCTCCGCGG - Intronic
1132805819 16:1774619-1774641 GCCAGGCTGTCTGCTGTCAGAGG - Intronic
1132905287 16:2279284-2279306 GCCGTGGTGGCTGCCCACAGTGG + Intronic
1133168454 16:3965108-3965130 GCCGCGCTCCCTGCACTGAGCGG - Exonic
1134255158 16:12604283-12604305 GCCGGGCAGCTTGAGCTCAGTGG + Intergenic
1135381670 16:22001051-22001073 CCCGGGCTGCCTGACCTCCCGGG - Exonic
1137343895 16:47636872-47636894 GCCGGGCTGCCACCCCTGGGTGG + Intronic
1137718131 16:50611395-50611417 GAGGGGCTGCCTGACTTCAGTGG - Intronic
1138439564 16:57025996-57026018 GCCTGCCTGCCTGCCTGCAGAGG + Exonic
1138553385 16:57759074-57759096 GCCCGCCTGCCTGCCCGCAGTGG - Intronic
1138554677 16:57764568-57764590 GCCTGCCTGCCAGCCATCAGAGG + Intronic
1139508129 16:67409841-67409863 GACCGGGTGCCTGCCCTCAGGGG + Intronic
1141253410 16:82379577-82379599 TCCCGGCTGCCTGGCCTCCGAGG - Intergenic
1141427934 16:83955746-83955768 CCCAGGCTGCCTGCCTTGAGGGG - Intronic
1141534745 16:84671192-84671214 AGCAGGCTGCCTGCCCCCAGGGG + Intergenic
1141665870 16:85464837-85464859 GCTGGGTTGACTGCCCACAGGGG + Intergenic
1141830723 16:86508792-86508814 ACCTGGCTGCCAGCCCGCAGGGG - Intergenic
1141948756 16:87327280-87327302 GCCTGCCTGCCGGCCCTCAGGGG - Exonic
1142837106 17:2594635-2594657 GCCGGGCTGCCTCTCCTCGGCGG - Intronic
1143130229 17:4672968-4672990 TCCGGGCCCCATGCCCTCAGTGG - Exonic
1143187552 17:5019829-5019851 CCCGTGCTGCCTGCCACCAGAGG + Intronic
1143749910 17:9020996-9021018 CCCGGGCTGCGTGCCCACAGGGG + Intergenic
1144570049 17:16391810-16391832 TCCGGGCGGCCAGCCCGCAGAGG - Intergenic
1146157310 17:30535321-30535343 GCCGGGCCTCCTGCTCTCCGAGG + Intergenic
1147424236 17:40338209-40338231 GCAGGCCTGCCTGCCCTTTGAGG + Intronic
1148158495 17:45436858-45436880 GCGTGGCTGCCTGCCCTCTCTGG + Exonic
1148667037 17:49382671-49382693 GCAGTGTTGCCTTCCCTCAGGGG + Intronic
1148808835 17:50277990-50278012 GCCAGGCTGTCTCCCCTCTGAGG + Intronic
1149217102 17:54370256-54370278 GCTGGGCTGCCTGACTCCAGGGG - Intergenic
1149600939 17:57892576-57892598 GCCGTGATGCCTGCCTGCAGAGG + Intronic
1150227447 17:63531650-63531672 GCCACTCTGCCTGACCTCAGAGG - Intronic
1151134245 17:71930423-71930445 GAAGAGCTGCCTGCCCTCAGTGG + Intergenic
1151733632 17:75925361-75925383 GCGGGACTGCCGGCCCTCAGAGG + Exonic
1151758970 17:76090044-76090066 TCAGGGCTCCCTGCCCTCAAGGG + Intronic
1151819562 17:76490286-76490308 GCCGGGCAGTCTGCCCTGGGGGG - Intronic
1152138952 17:78525186-78525208 GTAGGGCTACCTACCCTCAGCGG + Intronic
1152267693 17:79305816-79305838 GGGAGGCTGCCTGCCCACAGCGG - Intronic
1152652302 17:81500295-81500317 GCAGGTCAGCCTGTCCTCAGGGG + Intergenic
1152765312 17:82134142-82134164 GCCTGGCTTCCGGGCCTCAGGGG + Intronic
1152844371 17:82590923-82590945 GCTGGGCTGCCTGCCCTAAGGGG + Intronic
1154038704 18:10832948-10832970 GCCTCCCTGCCTGCCCTCCGGGG + Intronic
1154172986 18:12064032-12064054 CCAGGGCTTCCTGGCCTCAGGGG - Intergenic
1154376117 18:13811325-13811347 GCGGGGCTGTCTGCCCCGAGGGG + Intergenic
1154411479 18:14144368-14144390 GCCTTGCTGCCTCCCCTCTGGGG + Intergenic
1156371620 18:36476439-36476461 GCTGCCCTGCCTGCCCTCTGTGG - Intronic
1156591012 18:38488424-38488446 GCTGGGCTGCCTACCCTCAGGGG - Intergenic
1157174419 18:45438226-45438248 GAATGGCTGCCTGCTCTCAGGGG - Intronic
1160511376 18:79455432-79455454 GCCAGGCTGCCTCCCCAGAGGGG - Intronic
1160789450 19:916936-916958 GCGGGGAGGCCAGCCCTCAGCGG - Intergenic
1160792572 19:929431-929453 GCCGGGCCCCCTCCCCGCAGGGG + Exonic
1162765342 19:12915913-12915935 TCCAGGCTGGCTGCCCACAGGGG + Intronic
1162932060 19:13962348-13962370 GCCTGCCTGCCTGCCCCCTGGGG + Exonic
1163676458 19:18657823-18657845 GCAGGGCGGCCGGGCCTCAGGGG + Intronic
1164677613 19:30112216-30112238 GCCGACCTCCCTCCCCTCAGTGG - Intergenic
1165014568 19:32871153-32871175 GCAGGGCTGTCTGGCCCCAGCGG - Intergenic
1165104705 19:33462083-33462105 GCTGGCCTGCCTGCCATCAGTGG - Intronic
1165933013 19:39372535-39372557 CCCAAGCTGCCTGCCCTCAAAGG - Intronic
1166947422 19:46405602-46405624 GCCGGGCTGCCTGCCCAAAGGGG - Intergenic
1167278538 19:48553121-48553143 GGCAGGCTGCCTGCCCTCTCTGG - Intronic
1168192295 19:54748047-54748069 GCAAGGCTGCCTTCCCTCTGAGG + Intronic
1168196619 19:54779324-54779346 GCAAGGCTGCCTTCCCTCTGAGG + Intronic
1168202398 19:54825739-54825761 GCAAGGCTGCCTTCCCTCTGAGG + Intronic
1168207203 19:54859790-54859812 GCAAGGCTGCCTTCCCTCTGAGG + Intronic
925013205 2:501674-501696 GCCCTCCTCCCTGCCCTCAGAGG + Intergenic
926128376 2:10285663-10285685 GACGGGCTTCCTGCCCAGAGGGG - Intergenic
926156365 2:10456251-10456273 GGCGGGCTGGCTTCCCTCTGAGG - Intergenic
928178543 2:29051651-29051673 GCTGGGCTGCCAGCCCTTTGGGG + Intronic
928181759 2:29073013-29073035 CCAGGACTGCCTGCTCTCAGGGG - Exonic
928594568 2:32847627-32847649 CCCTGGCCACCTGCCCTCAGAGG - Intergenic
930698909 2:54439723-54439745 CCTGGGCTGCCTGCTCTCCGTGG - Intergenic
932339850 2:70956356-70956378 ACCCGGCTGCCTGCCCCCATGGG + Intronic
933438735 2:82282638-82282660 GCTGGGCTGCCTGACTCCAGGGG - Intergenic
933835659 2:86243352-86243374 GCCTGCCTGCCTGACCTCACAGG - Intronic
934013786 2:87855844-87855866 GGCGGGTTGCCTGAGCTCAGGGG - Intergenic
935590438 2:104842842-104842864 GCCGCGCTGCCTCCCCACAGGGG - Intergenic
936091432 2:109504022-109504044 GCCGGGCTGCCTGAGAGCAGAGG + Intronic
937363635 2:121245605-121245627 GCCGGGCTGCCTGACCGTTGTGG - Intronic
937951005 2:127387929-127387951 GCCGGGCTGCCTGCCCTCAGCGG - Intronic
938063295 2:128268194-128268216 GCCGGGCCGCGTGCCCACCGAGG - Exonic
939864897 2:147461658-147461680 GCTGGGCAGGCTGCACTCAGGGG - Intergenic
941037017 2:160579917-160579939 TTTGGGCTGCCTGCCCTCAGAGG + Intergenic
945248209 2:207740490-207740512 TCCGGGATGCCAGCCTTCAGAGG - Intronic
947866328 2:233400340-233400362 TCCAGGCTCCCTGCCCTCCGAGG - Intronic
948075822 2:235164433-235164455 CCCTGGATGCCTGCTCTCAGGGG - Intergenic
948785565 2:240350692-240350714 GCAGGGCTGGCTCCTCTCAGGGG - Intergenic
949009883 2:241672361-241672383 CCCGTGCTGCCTCCCCCCAGAGG + Exonic
1168819375 20:762807-762829 GCTGGCCTGCCTGTCCTCACTGG - Intronic
1168960910 20:1869016-1869038 GCCTGGCTGACTGCCCTAAATGG + Intergenic
1169131123 20:3166896-3166918 GCCGGGCCGCTACCCCTCAGAGG - Exonic
1169285021 20:4300683-4300705 GCCATGCTGGCTGCCCTGAGCGG - Intergenic
1170605225 20:17870474-17870496 ACCGGGCTGCCTGCGCTGGGGGG - Intergenic
1170705212 20:18738425-18738447 GCCTGGTTGCCTCCCCTAAGGGG + Intronic
1172031829 20:31987790-31987812 GCCTGTCTGCCTGCCCTTAGAGG - Intronic
1172512529 20:35510347-35510369 CCTGGCCTCCCTGCCCTCAGAGG + Intronic
1172610405 20:36246959-36246981 GCCAGGGTTCCTGCCCTCAAGGG + Intronic
1172919031 20:38465952-38465974 GCAGTTCTGCCTACCCTCAGTGG + Intergenic
1173210694 20:41029287-41029309 GCAGGGATGGCTGCCCTCTGTGG + Intronic
1173461073 20:43243826-43243848 GCCTGCATGCCCGCCCTCAGAGG - Intergenic
1173590296 20:44219803-44219825 GCCGGTCTGCTGACCCTCAGGGG + Intergenic
1173865103 20:46308193-46308215 GCCGGGCAGCCTCCCCTCGGCGG + Intronic
1174334731 20:49851481-49851503 GCAAGGCTGTCTGCTCTCAGAGG - Intronic
1175448449 20:59042652-59042674 GCCGGCGTGCCTGCCCTCCACGG + Intronic
1175743143 20:61434849-61434871 CCTGGGCTGCCTGCCTTCATGGG + Intronic
1175986723 20:62767825-62767847 GTGGGGCTGTCAGCCCTCAGGGG - Intergenic
1176117569 20:63439752-63439774 GGCGTCCAGCCTGCCCTCAGGGG - Intronic
1176861575 21:14014049-14014071 GCCTTGCTGCCTCCCCTCTGGGG - Intergenic
1179421483 21:41240154-41240176 GCTGGGCAGACTGCCCACAGGGG + Intronic
1179881986 21:44296742-44296764 GCCAGGGTGCAGGCCCTCAGGGG - Intronic
1180159684 21:45993475-45993497 GCCGAGCTGCCAGGCCTCAGAGG + Intronic
1181557962 22:23683019-23683041 GCCAGGCTGCCGACCCACAGGGG + Intergenic
1182146351 22:27999086-27999108 GCTGGGCTGCCAGCCCCTAGTGG - Exonic
1182237122 22:28884202-28884224 GCCCGCCTGCCCGCCCGCAGGGG - Intronic
1182301655 22:29340450-29340472 GCCAGGCAGCCTTCCCTCCGAGG - Intronic
1183464261 22:37971728-37971750 ACCGTGCTGCCTGCAGTCAGAGG - Intronic
1184646586 22:45898619-45898641 GCTGGGCTGCCTGGCCTCCTGGG - Intergenic
1184687817 22:46104426-46104448 GCCTGCCTGCCTGCCCTTGGCGG + Intronic
1185057338 22:48587863-48587885 GGCCTTCTGCCTGCCCTCAGGGG + Intronic
1185366725 22:50440232-50440254 GCCTTGCTGCCTCCCCTCTGGGG - Intronic
950093608 3:10315157-10315179 GCCAGCCTGGCTGTCCTCAGCGG - Intronic
950535462 3:13575762-13575784 GCCTGGCTGCATGCCCTCCCTGG + Intronic
951537314 3:23751599-23751621 GCCCGGCTACCTTCTCTCAGGGG - Intergenic
952953484 3:38542639-38542661 GCCGGCCTGTCTGTCCACAGAGG + Intergenic
954808211 3:53232415-53232437 GCCCACCTGCCTGCTCTCAGGGG - Intronic
956066572 3:65402872-65402894 GCCTGGCTCCCAGACCTCAGAGG + Intronic
961167650 3:124774543-124774565 GCAGGGCTGCATTCCCTCTGAGG - Intronic
961389114 3:126541987-126542009 GCCTGGCCGCCTGCCCTCACTGG + Exonic
961454096 3:127015841-127015863 GCCTGGCTGCCTGCCCAGTGGGG + Intronic
961484452 3:127207287-127207309 GCAGGTGTGCCAGCCCTCAGAGG - Intergenic
966574758 3:181487956-181487978 GCCAGGCTCCCTTCCCTCAGTGG + Intergenic
967882361 3:194310733-194310755 GCAGGGCTGCCCGCCATCAGGGG + Intergenic
968073927 3:195805518-195805540 GCCTGGCTGCCTCTCCACAGTGG + Intronic
968616560 4:1580263-1580285 GCGAGGCTGCCTGGCCTCCGCGG - Intergenic
968653643 4:1769612-1769634 GCCCTGCTGCCTGGTCTCAGTGG - Intergenic
969054332 4:4392240-4392262 GCCAGCCTGGCTGCCTTCAGAGG + Intronic
969623738 4:8292057-8292079 GCGGTGCTGCCTGGCCTCCGGGG + Intronic
969713705 4:8858608-8858630 GCCCGGGGGCCTGCGCTCAGGGG - Intronic
971852184 4:31996855-31996877 GCCCGGCTGGCTTCACTCAGTGG - Intergenic
972737462 4:41857509-41857531 GCCGGCCTGCCTCGTCTCAGAGG - Intergenic
974108263 4:57495883-57495905 GCTGCACTCCCTGCCCTCAGAGG + Intergenic
975597743 4:76066380-76066402 GACGACCTGCCTGCCCACAGAGG - Intronic
976512901 4:85931314-85931336 GCTGGGCTGACCGTCCTCAGAGG + Intronic
976744624 4:88390843-88390865 GCCGGGCAGCTGGCCCTCAGTGG + Exonic
980730080 4:136812646-136812668 GCCCAGCTGCCTGCCAGCAGGGG - Intergenic
981504913 4:145489197-145489219 GCAGCCCTGCCTGACCTCAGTGG + Intronic
982115978 4:152098787-152098809 GCCTGGCTGTGTGGCCTCAGTGG + Intergenic
985554036 5:547381-547403 GCCTGGCTGCCTGGCCCCTGTGG - Intergenic
985577599 5:680880-680902 GCCTGGCTGACTTCCCACAGCGG - Intronic
985592529 5:772978-773000 GCCTGGCTGTCTTCCCACAGCGG - Intergenic
985694297 5:1331256-1331278 CCTGGGCTGCCTGGCCTCAGGGG + Intronic
985981939 5:3477344-3477366 GCCTGGCCAGCTGCCCTCAGGGG - Intergenic
986758213 5:10857197-10857219 GCTGCGCTGCCTGCCAGCAGGGG + Intergenic
989002256 5:36773594-36773616 GCAGGGCTGCCCTCCCTCTGGGG - Intergenic
996234097 5:121106688-121106710 GACGACCTGCCTGCCCACAGAGG - Intergenic
997233460 5:132259334-132259356 ACGCGGCTGCCTGCCCTCCGAGG + Intronic
997309418 5:132867103-132867125 GCCCGGCCGCCAGCGCTCAGAGG - Intronic
999254534 5:150202707-150202729 GGCAGGCTGCCAGGCCTCAGTGG + Intronic
999328635 5:150658452-150658474 GCCTGGCTGCAGGCCCTCACTGG + Intronic
999699665 5:154217132-154217154 TGGGGGCTGCCTGACCTCAGAGG - Intronic
1000385677 5:160672631-160672653 CCCGGTCTGGCTGCCTTCAGAGG - Intronic
1001474459 5:172040263-172040285 GCCGGCCTGCCTGCCATTAAGGG - Intergenic
1001956625 5:175852139-175852161 GTTGGACTGCCTACCCTCAGGGG - Intronic
1002046004 5:176542240-176542262 GCAGGGCAGGCTGGCCTCAGGGG - Intergenic
1002186836 5:177458581-177458603 GCAGGGCTGCCTGGCCCCCGGGG + Exonic
1002426294 5:179178218-179178240 GGCTGGCTGCCTGCCTCCAGTGG - Intronic
1002632735 5:180591702-180591724 CCGGGCCTGCCTGCTCTCAGAGG - Intergenic
1002898612 6:1393072-1393094 GCCGGGCCCCCAGGCCTCAGTGG - Intronic
1003245467 6:4378600-4378622 GCAGGTCTGGCTGCCCTCACAGG - Intergenic
1006554802 6:34856832-34856854 GGCAGGCTGTCTGCCCTGAGAGG - Exonic
1006992511 6:38227558-38227580 GCAGGGCTGGCTGGCCACAGTGG + Intronic
1007451361 6:41941946-41941968 GCCGGCCGGCTTGCGCTCAGCGG - Intronic
1008410101 6:51167623-51167645 CCCAGGCTGCCTGCTCTCAGGGG - Intergenic
1011665338 6:89627746-89627768 GCAGGCCTGCCTGAGCTCAGTGG - Intronic
1018461718 6:164004931-164004953 GCCTGGCTGACTGCCCTCCATGG + Intergenic
1018711365 6:166500156-166500178 GCAGGGCTGCCTGCCTTTTGGGG - Intronic
1019047089 6:169157613-169157635 GGCGGGCTCCGTGCCCTCCGGGG - Intergenic
1019544697 7:1568297-1568319 GGCGCCCTGCTTGCCCTCAGTGG - Intronic
1028102966 7:86844282-86844304 GTCTGGCTGCCTCCCTTCAGTGG - Intronic
1030820441 7:114086137-114086159 GCGGGGCTGCCTCTCCTCGGAGG - Intergenic
1032245780 7:130210695-130210717 GCAGGAGTGCCTGCCCTGAGGGG - Intronic
1035205831 7:157293221-157293243 GCAGCTCTCCCTGCCCTCAGGGG - Intergenic
1035534909 8:383613-383635 GCCCTCCTGCCTGCCCTCACTGG - Intergenic
1035770852 8:2145632-2145654 GCTGGGCTGCTGGCCCCCAGCGG + Intronic
1037599786 8:20384363-20384385 CCCAGGCTGCCAGCCCTCTGAGG - Intergenic
1037760690 8:21739645-21739667 GCAGGGCTGCCTCCCCCCTGGGG + Intronic
1040298550 8:46175963-46175985 GGCGGGCTGCAGGCACTCAGGGG + Intergenic
1041215484 8:55596142-55596164 GCCAGGCTTCCTGACCTCTGAGG - Intergenic
1045504311 8:102767743-102767765 CTTGGGCTCCCTGCCCTCAGTGG + Intergenic
1047772964 8:128045197-128045219 GCCGTGGTGCCTGCCCACAAGGG - Intergenic
1048303579 8:133268134-133268156 GCATAGCTGCCTGCTCTCAGTGG + Intronic
1048974799 8:139665188-139665210 GCAGGGCTGCCTACCTTCTGAGG + Intronic
1049003646 8:139841496-139841518 TCCGTGCTGCCTGACTTCAGGGG - Intronic
1049325664 8:142020239-142020261 CCTGGGCTCCCTGCCCTCCGTGG - Intergenic
1049446172 8:142632568-142632590 GTCGGGGGGCCTCCCCTCAGAGG + Intergenic
1049651340 8:143771324-143771346 GCCGGGGTTCCCGCCCGCAGAGG - Intergenic
1049710405 8:144060619-144060641 GCCGGGCGGCCTCCCCTCCGCGG - Intronic
1057133249 9:92669525-92669547 GCCGGACTGCCAGGCCGCAGTGG - Intronic
1058334297 9:103806129-103806151 GCCTGGCTGACTGCCTTCTGAGG - Intergenic
1060411477 9:123403187-123403209 GCCCGGCTCCCTGGCCTCTGGGG + Intronic
1060877916 9:127096414-127096436 GCTGGGCTGCTCGCTCTCAGTGG - Intronic
1061014430 9:127973718-127973740 GCAGGGCTGGGTGGCCTCAGAGG - Intronic
1061801293 9:133114682-133114704 GCCTGGGCACCTGCCCTCAGGGG - Intronic
1061808372 9:133148874-133148896 GCCGGGCTCCCTCCCCCCGGTGG + Intronic
1062045766 9:134423804-134423826 GCAGGCCTGCCTGACCCCAGTGG + Intronic
1062091347 9:134680209-134680231 GCCTGGATGGCTGCCCTGAGTGG - Intronic
1062322038 9:135994746-135994768 GCCGGGCCGGGTGCCCTCACAGG - Intergenic
1186274691 X:7927018-7927040 GCCGAGCCACCTGCCCTCACAGG - Intronic
1199130688 X:144182629-144182651 GGCGGGTTGCCTGAGCTCAGGGG + Intergenic
1199767248 X:150950149-150950171 TCCAGCCTGCCTGCCCTCGGGGG - Intergenic
1200885228 Y:8260958-8260980 GCCTGTGTGCCTGCTCTCAGAGG + Intergenic
1201058492 Y:10019399-10019421 GCCTGTTTGCCTGCTCTCAGAGG + Intergenic
1202584411 Y:26408696-26408718 GCTGTGCTGCCTGCCCCCGGGGG - Intergenic