ID: 937951006

View in Genome Browser
Species Human (GRCh38)
Location 2:127387944-127387966
Sequence AGCCCGGCAGCCACTACACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937951005_937951006 -8 Left 937951005 2:127387929-127387951 CCGCTGAGGGCAGGCAGCCCGGC 0: 1
1: 0
2: 3
3: 33
4: 269
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data
937950994_937951006 24 Left 937950994 2:127387897-127387919 CCCAGCGGCCGCGGCACCCTCGT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data
937950997_937951006 16 Left 937950997 2:127387905-127387927 CCGCGGCACCCTCGTCAGGCGCC 0: 1
1: 0
2: 2
3: 7
4: 90
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data
937951003_937951006 -5 Left 937951003 2:127387926-127387948 CCGCCGCTGAGGGCAGGCAGCCC 0: 1
1: 0
2: 3
3: 21
4: 239
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data
937950999_937951006 7 Left 937950999 2:127387914-127387936 CCTCGTCAGGCGCCGCCGCTGAG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data
937950998_937951006 8 Left 937950998 2:127387913-127387935 CCCTCGTCAGGCGCCGCCGCTGA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data
937950995_937951006 23 Left 937950995 2:127387898-127387920 CCAGCGGCCGCGGCACCCTCGTC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937951006 Original CRISPR AGCCCGGCAGCCACTACACA CGG Intronic
No off target data available for this crispr