ID: 937951780

View in Genome Browser
Species Human (GRCh38)
Location 2:127393807-127393829
Sequence ATCTGGTGCTAGGTGTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937951775_937951780 16 Left 937951775 2:127393768-127393790 CCTGGTTTCTTTTGTTGGAGAAT No data
Right 937951780 2:127393807-127393829 ATCTGGTGCTAGGTGTGCTAAGG No data
937951772_937951780 25 Left 937951772 2:127393759-127393781 CCAAAGGGCCCTGGTTTCTTTTG No data
Right 937951780 2:127393807-127393829 ATCTGGTGCTAGGTGTGCTAAGG No data
937951774_937951780 17 Left 937951774 2:127393767-127393789 CCCTGGTTTCTTTTGTTGGAGAA No data
Right 937951780 2:127393807-127393829 ATCTGGTGCTAGGTGTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937951780 Original CRISPR ATCTGGTGCTAGGTGTGCTA AGG Intergenic
No off target data available for this crispr