ID: 937952662

View in Genome Browser
Species Human (GRCh38)
Location 2:127400842-127400864
Sequence GCCCCTCTGCTGCTGGGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937952649_937952662 26 Left 937952649 2:127400793-127400815 CCCTTTGGAGGAGTCACTTATGA No data
Right 937952662 2:127400842-127400864 GCCCCTCTGCTGCTGGGAACCGG No data
937952650_937952662 25 Left 937952650 2:127400794-127400816 CCTTTGGAGGAGTCACTTATGAG No data
Right 937952662 2:127400842-127400864 GCCCCTCTGCTGCTGGGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937952662 Original CRISPR GCCCCTCTGCTGCTGGGAAC CGG Intergenic
No off target data available for this crispr