ID: 937953116

View in Genome Browser
Species Human (GRCh38)
Location 2:127403533-127403555
Sequence ACCTGGAGGCTGCAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937953116_937953120 -9 Left 937953116 2:127403533-127403555 CCTCCCAACTGCAGCCTCCAGGT No data
Right 937953120 2:127403547-127403569 CCTCCAGGTGTACACCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937953116 Original CRISPR ACCTGGAGGCTGCAGTTGGG AGG (reversed) Intergenic
No off target data available for this crispr