ID: 937954815

View in Genome Browser
Species Human (GRCh38)
Location 2:127416238-127416260
Sequence CAGGCTGCCCAGAGGGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937954815_937954830 19 Left 937954815 2:127416238-127416260 CCTTCCGCCCTCTGGGCAGCCTG 0: 1
1: 0
2: 2
3: 38
4: 327
Right 937954830 2:127416280-127416302 ACCCCCAGCACTGGGCACTTGGG 0: 1
1: 0
2: 2
3: 22
4: 268
937954815_937954829 18 Left 937954815 2:127416238-127416260 CCTTCCGCCCTCTGGGCAGCCTG 0: 1
1: 0
2: 2
3: 38
4: 327
Right 937954829 2:127416279-127416301 AACCCCCAGCACTGGGCACTTGG 0: 1
1: 0
2: 2
3: 28
4: 268
937954815_937954823 10 Left 937954815 2:127416238-127416260 CCTTCCGCCCTCTGGGCAGCCTG 0: 1
1: 0
2: 2
3: 38
4: 327
Right 937954823 2:127416271-127416293 GCACCCCCAACCCCCAGCACTGG 0: 1
1: 1
2: 12
3: 82
4: 681
937954815_937954824 11 Left 937954815 2:127416238-127416260 CCTTCCGCCCTCTGGGCAGCCTG 0: 1
1: 0
2: 2
3: 38
4: 327
Right 937954824 2:127416272-127416294 CACCCCCAACCCCCAGCACTGGG 0: 2
1: 1
2: 7
3: 129
4: 961

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937954815 Original CRISPR CAGGCTGCCCAGAGGGCGGA AGG (reversed) Intergenic
900099799 1:956956-956978 CAGAGTCCCCAGAGGGCTGAAGG - Exonic
900618459 1:3576181-3576203 CTGTCTGCCCGGAGGGTGGAGGG - Intronic
900659333 1:3774887-3774909 CAGCCTCCCCAGAGGCCAGAAGG + Intronic
900840222 1:5042690-5042712 CAGGCTGGTCAGAAGGCAGAAGG - Intergenic
901326827 1:8371718-8371740 CAGATTGCCCAGGCGGCGGAGGG - Intronic
901800276 1:11704463-11704485 GAGGCAGCCCAGGGGGAGGAGGG - Intronic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902174182 1:14637048-14637070 CAGGCTGCCCAGAGAGCCCAGGG + Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902627461 1:17684838-17684860 CAGGCTCCCCAGAGGAGGGGAGG - Intronic
902644391 1:17788444-17788466 CTGGCTGCTCCGAGGGCTGAGGG - Intronic
903218319 1:21855122-21855144 CAGGCAGCCAAGAGGACGGCAGG + Intronic
903233494 1:21935877-21935899 GAGGCTGCCCAGAGTGGGGATGG + Intronic
904293705 1:29504191-29504213 TTGGCTGCCCAGAGGCAGGAGGG - Intergenic
904463118 1:30692274-30692296 AAGGAAGCCCAGAGGGAGGAGGG + Intergenic
906019264 1:42613162-42613184 GAGGCTGCCCCGAGGGCTGCTGG + Intronic
909233331 1:73119509-73119531 CAGGCTCCCCAAAGGGCCTATGG + Intergenic
912697479 1:111852327-111852349 CAGGCCCCACAGAGGGCTGAGGG - Intronic
915791296 1:158674507-158674529 AAGGCTGCCCAGTAGGAGGAGGG - Intronic
916449606 1:164907476-164907498 GAGCCAGCCCAGAGGGCTGATGG + Intergenic
917724299 1:177814283-177814305 AGGGCTGCCCAGGGGGAGGAGGG + Intergenic
919780010 1:201215649-201215671 CAGGCTGCCTGGAGGAAGGACGG + Exonic
919814878 1:201431081-201431103 CAGGCTGGGCACAGGGTGGAGGG - Intergenic
919817858 1:201452944-201452966 CAGGATGCCCTGAGGTAGGAAGG + Intergenic
919942428 1:202297546-202297568 CAGTCTGCCCAGGGTCCGGATGG - Exonic
920007678 1:202845248-202845270 CAGGCTGCCCAGAGTGCCCCAGG + Intergenic
922079269 1:222279083-222279105 CTGGCTGTCCAGAGAGCAGAAGG + Intergenic
922925315 1:229342731-229342753 AGGGCTGCTCAGTGGGCGGAAGG + Intronic
922980108 1:229818530-229818552 CAGCCTTCCCAGAGGTCAGAAGG + Intergenic
923242262 1:232097368-232097390 CTGGCTGCCCTGGGGGAGGAAGG + Intergenic
1063172995 10:3526414-3526436 CAGGCAGCCCAGAGCACTGATGG - Intergenic
1064620297 10:17208706-17208728 CAGGCTGACCTGAGGACTGAGGG + Intergenic
1064892018 10:20186568-20186590 GAGGCCTACCAGAGGGCGGAGGG - Intronic
1067035868 10:42916096-42916118 GTTGCTGCCCAGAGGGCTGAAGG - Intergenic
1067145328 10:43689790-43689812 CAGGCTGCCGAGAGCCCGGCCGG + Intergenic
1067409014 10:46048465-46048487 CCAGCTGCCCACAGGGAGGAAGG + Intergenic
1069438349 10:68406703-68406725 AAGGCTGCCCAGAGGCCTGGGGG + Intronic
1070783850 10:79151956-79151978 CAGGGGGCCCAGATGGCGGCGGG - Intronic
1070849957 10:79555586-79555608 GTGGCTGCGCAGAGGACGGAAGG + Intergenic
1071298171 10:84237554-84237576 CAGGCGGCCCAGGGGCCTGAAGG + Exonic
1073186924 10:101620562-101620584 CAGGCTGGCCAGAGCGGGCAGGG + Intronic
1073425253 10:103452072-103452094 CACGCTGCCCAGAGGGAGAGAGG - Intronic
1075790660 10:125082171-125082193 CAGGCTGCCTGGGGGGAGGAGGG - Intronic
1076394652 10:130129758-130129780 CAGGCTGCGCAGTGGGAGAAGGG - Intergenic
1076680801 10:132170273-132170295 CAGGGTCCCCCGAGGGCGGCTGG + Intronic
1076923862 10:133471504-133471526 GAGACAGCCCAGAGGGAGGAAGG - Intergenic
1077035990 11:494775-494797 CAGGCTGCACACAGGCCAGAAGG + Exonic
1077109027 11:854009-854031 CAGGCAGCACAGAGGCCTGAAGG - Intronic
1077211103 11:1371321-1371343 CAGGCTCCCCGGGGGGCGGGCGG + Intergenic
1077309472 11:1882014-1882036 CAGCCAGCCCCGAGGGAGGAAGG - Intronic
1077327326 11:1969410-1969432 CAGGCTGCCCGGAAGGAGGGTGG - Intronic
1083299476 11:61732801-61732823 CAGCCTGGCCAGAGGGAGAAGGG + Intronic
1083618960 11:64039605-64039627 CAGGCTGTCCGGGGGGAGGAGGG - Intronic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1084033097 11:66492491-66492513 CAGGCGGCCCAGGGGCCTGAGGG + Intronic
1084192753 11:67506239-67506261 CAGGCTGCCCACAGCGCCAAGGG + Intronic
1084438148 11:69155980-69156002 CAGGCAGCCCAGTGGGTGCAGGG + Intergenic
1088875863 11:113935797-113935819 CAGGCTGCCCAGCGGGAGGTTGG + Intronic
1089100452 11:115958443-115958465 CATGCTGCCCAGGGAGGGGAGGG - Intergenic
1089302544 11:117507395-117507417 AGGGGTGCCCTGAGGGCGGAGGG - Intronic
1089360631 11:117883959-117883981 CAGGCTGCCCCCAAGGCTGATGG - Intergenic
1090718499 11:129451753-129451775 CTGGCTGCCCAGAGGTCAGGAGG - Exonic
1091009521 11:131985941-131985963 GGGGCTGCCTAGAGGGCGGAGGG - Intronic
1091154930 11:133363317-133363339 AAGGCAGCGCAGAGGGCCGAGGG + Intronic
1202810308 11_KI270721v1_random:24590-24612 CAGGCTGCCCGGAAGGAGGGTGG - Intergenic
1092173273 12:6386186-6386208 GAGGCTTCTCAGAGGGTGGAAGG - Intronic
1096978933 12:55717371-55717393 CAGGCTTGCCAGAGGGTGGGAGG - Intronic
1098106085 12:67069706-67069728 CAGGCCGCCCGGGGCGCGGAGGG - Intergenic
1099504887 12:83461584-83461606 CAGGCTGCCCAGAGGAAGAAGGG + Intergenic
1099585144 12:84505640-84505662 AAGACTGCCCTGAGGGCTGAAGG - Intergenic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102431673 12:112888987-112889009 CAGGCTGCCCAGAGAGACCAGGG - Intronic
1102532001 12:113553498-113553520 CAGGAACCCCAGAGGGCTGAGGG + Intergenic
1102588491 12:113940059-113940081 CAGGCTGCCAAAATGGCCGAAGG + Exonic
1103794090 12:123491405-123491427 GAGGCTGCCCAGAGGCCTTAGGG + Intronic
1104714236 12:131005953-131005975 CAGGCTGCAGAGAGAGCAGAGGG - Exonic
1105402069 13:20104935-20104957 CAGCCTGCCCAGAGAGTGCAGGG + Intergenic
1105614335 13:21998712-21998734 CAGGGAGCTCAGAGGGTGGAGGG + Intergenic
1105726224 13:23164907-23164929 CAGGCTGCCCTGAAGAGGGAAGG - Intergenic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1113250634 13:108448781-108448803 CAGGCTACCCAGAGGGCTAAAGG + Intergenic
1113378980 13:109786248-109786270 CAGGAGCCCCAGAGCGCGGAGGG - Exonic
1113424698 13:110198476-110198498 CAGGCTGCCCAGGGGGCCCAGGG + Exonic
1113559791 13:111269585-111269607 AGGGCTGCCCAGAGAGTGGAGGG + Intronic
1113611135 13:111645724-111645746 CAGGCTGAGCAGGGGGCTGATGG + Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1113911551 13:113843697-113843719 CAGGCGGCACAGTGGACGGAGGG - Intronic
1114626179 14:24131691-24131713 GGGGCTGCCCAGAAGGCGGGCGG - Exonic
1117699086 14:58395865-58395887 CAGGAGGCCCCGAGGCCGGATGG + Intergenic
1119003853 14:70907376-70907398 TAGCCGGCCCAGGGGGCGGAGGG + Intergenic
1119539401 14:75428500-75428522 CCGGCTGTCCAGGGAGCGGACGG - Intronic
1119552503 14:75525234-75525256 AAGGGTTCCCAGATGGCGGAGGG - Intronic
1119586310 14:75839103-75839125 CAGGCAGCCCAGCATGCGGATGG + Intronic
1119878956 14:78085006-78085028 CAGGCTGCCCAGCAGGTGGTTGG + Intergenic
1120999366 14:90440448-90440470 AAGGATGCTCAGAGGGCTGATGG + Intergenic
1121586739 14:95067963-95067985 CAGGCTGCACAGAGGCTGGAAGG - Intergenic
1121882598 14:97514375-97514397 CAGGCAGGCAAGAGGGAGGAAGG - Intergenic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1122578671 14:102757612-102757634 CAGGTTGCCCAGACGCTGGAGGG - Intergenic
1122794684 14:104200229-104200251 CAGGCTGCACAGTAGGCAGATGG - Intergenic
1122843167 14:104476605-104476627 CAGGGTGCCCAGAGGAAGGTGGG + Intronic
1123019398 14:105390579-105390601 CAGGTTGCCCAGGCAGCGGAAGG + Intronic
1124192032 15:27587875-27587897 CAGGATTCGGAGAGGGCGGAGGG + Intergenic
1126968535 15:54083690-54083712 TAGGCTGCCCCAAGGGAGGAGGG - Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129276389 15:74448486-74448508 TGGGCTGCCCAGAGGCCTGAAGG + Exonic
1129705762 15:77793192-77793214 AAGGCTCCCCAGAGAGCAGAGGG + Intronic
1131097985 15:89667785-89667807 CAGGCTGCTCTGAGGGAGGATGG + Exonic
1132058346 15:98669682-98669704 AAGGCTGCCCAGAGGATGGAGGG - Intronic
1132110159 15:99096966-99096988 CAGGCCTAGCAGAGGGCGGATGG + Intergenic
1132717849 16:1301082-1301104 CAGGCAGCCCAGGAGGCGGACGG + Intergenic
1133015003 16:2935621-2935643 CAGGCTGCCCCTCCGGCGGAGGG - Intronic
1133220430 16:4317112-4317134 CAGCCTGGCCAGAGGGTGGCCGG + Intronic
1134063439 16:11212381-11212403 CGCACTGCCCAGAGGGCAGAAGG + Intergenic
1134638343 16:15809571-15809593 CAGACTGCCCAGAGGCTGGGAGG + Intronic
1135701567 16:24637349-24637371 CAGGCTGCCCAGACCACAGATGG - Intergenic
1136580021 16:31145801-31145823 CTGGCTACCCAGAGGGCCGCAGG - Exonic
1138565984 16:57833229-57833251 CAGGATGCCAGGAGGGCAGAGGG + Intronic
1138613716 16:58147764-58147786 CAGGCAGCACTGAGGGAGGAGGG - Intergenic
1138655780 16:58490475-58490497 CAGGGTGCCCAGAGGGCATGAGG - Intronic
1139960570 16:70715138-70715160 CAGGTTGCCCAGAGGGTGTGGGG + Intronic
1140409769 16:74734614-74734636 CCTGCTGCCCAGAGGGTGGGCGG + Intronic
1141560810 16:84866635-84866657 CAGGCTGCCCAGAGGTTAGCAGG - Intronic
1141677143 16:85523892-85523914 CAGGCTGAGCAGAGGTGGGAGGG + Intergenic
1142037131 16:87869322-87869344 CTGGCCGCCAAGAGCGCGGACGG - Exonic
1142289114 16:89184669-89184691 CAGGCTGGGCAGAGGACGCAGGG - Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1143008547 17:3852912-3852934 AAGGCTTCCCAGAGGAAGGAAGG - Intergenic
1143186488 17:5013427-5013449 CAGGCTGTCCTGAAGGCGGTTGG + Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143670577 17:8393153-8393175 CAGGCTGTCCAGTGGGGGCACGG + Exonic
1144577654 17:16439153-16439175 AAGCCTGTCTAGAGGGCGGAGGG + Intergenic
1144756002 17:17681244-17681266 CAGGCCGGCCAGCGGGCGGGGGG + Intergenic
1145937929 17:28726112-28726134 GAGGCGGCCTCGAGGGCGGACGG - Exonic
1146531327 17:33609944-33609966 CAGGCTGCTCACCGGGAGGAGGG - Intronic
1147213166 17:38883944-38883966 AAGGCTGCCCACAGGCGGGAAGG - Intronic
1147537410 17:41329522-41329544 CAGGCTGACCACACTGCGGAAGG + Intergenic
1147612860 17:41811948-41811970 CTGGCTGCCCCGCGGACGGAAGG + Exonic
1148027784 17:44600335-44600357 CTGGCTTCCCAGAGGCTGGAGGG + Intergenic
1148134527 17:45283805-45283827 CACCCTGCCCAGAGGGCCAAGGG + Intronic
1148637516 17:49159995-49160017 CAGGCTGCCCTGAGAGTGGCAGG - Intronic
1151133772 17:71925165-71925187 CAGGGTGCCCAGATCGCTGAAGG + Intergenic
1151231747 17:72690065-72690087 CACGCTCCCCAGAAGGAGGAAGG - Intronic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1151370911 17:73645489-73645511 AAGGCTGGGCAGAGAGCGGAGGG - Intergenic
1151482747 17:74379960-74379982 CAAGCTCCCCAGAGTGGGGAAGG - Intergenic
1151662149 17:75524950-75524972 CAGGCTTCCCGAAGGGAGGAGGG + Intergenic
1152697404 17:81804025-81804047 GAGGCTGCGCGGAGGGCGGGCGG + Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1156451244 18:37267524-37267546 GGGACTGCCCAGAGGGAGGATGG + Intronic
1156481132 18:37437111-37437133 CAGGCTCCCCAGTGGGTGGCAGG + Intronic
1156578862 18:38351790-38351812 CTGGCTGCCCAGAGTGGGGATGG + Intergenic
1157221711 18:45832871-45832893 AAGGCTGCCCAGAGGACTCAGGG - Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1160455652 18:78997165-78997187 CATGCTGCCCAGAGGGGGGAGGG - Exonic
1161015676 19:1981664-1981686 CTGGCTGCTCTGACGGCGGAAGG + Intergenic
1161340722 19:3740574-3740596 GAAGCTGCCCAGAGGGCCGTGGG + Exonic
1161470934 19:4456515-4456537 CTGGCTGGCCAGAGGGTGGTGGG - Intronic
1162038250 19:7953850-7953872 GAGGCTGCCCTGGAGGCGGAGGG + Intergenic
1163289976 19:16372896-16372918 TTGGCTGCCCAGAGGACAGAAGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164158220 19:22609557-22609579 CAGAATGCCCAGGGAGCGGAGGG - Intergenic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1164826668 19:31289353-31289375 AAGGCTGCCCAGAGTGAGGAGGG - Intronic
1165274554 19:34736863-34736885 CAGGCTGCCCAGACAACTGAAGG + Intronic
1166364384 19:42271053-42271075 CAGGCTGCCCAGAGGGGCAGAGG + Intronic
1167497423 19:49827800-49827822 CAGACAGCCCAGAGAGGGGAGGG + Intronic
1168333190 19:55581077-55581099 CCGGGCTCCCAGAGGGCGGAGGG + Intergenic
925358988 2:3264147-3264169 GAGGCTGGCGGGAGGGCGGATGG - Intronic
925381631 2:3431372-3431394 CATCCAGCCCAGAGGGCGGCAGG + Intronic
925880181 2:8345746-8345768 CAGGGTGCCCAGAGGAGGCATGG - Intergenic
926795330 2:16614531-16614553 CAGGCTCTCCAGAGGGTGAAAGG - Intronic
928205644 2:29281333-29281355 CAGGCTGCCCACAGAGAGGAAGG - Intronic
931589400 2:63865315-63865337 CCAGCTGCCTAGAGGGCTGAAGG + Intronic
932103962 2:68926214-68926236 CAAGCTGCCCAGAGGTTGGAAGG + Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932607849 2:73176441-73176463 CAGGGCCCCCAGAGGTCGGAAGG + Intergenic
934522614 2:95029261-95029283 CAGGTGGCCCTGAGGACGGAGGG - Intronic
935301597 2:101697866-101697888 CGGGCCGCGCGGAGGGCGGACGG - Intronic
936251946 2:110874076-110874098 GAGGATGCCCAGAGGGCAGGTGG + Intronic
936917869 2:117658685-117658707 CAGGTAGCCCAGATGGAGGAAGG + Intergenic
936919448 2:117672618-117672640 CAGGCTGCCCAGTGTTCGGCTGG + Intergenic
937312558 2:120911038-120911060 CAGGCTGCCCTGAGGGGGAGTGG + Intronic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
938294813 2:130171620-130171642 CAGATTCCCCAGAGGGTGGAGGG - Intronic
938303085 2:130229768-130229790 CAGAGTCCCCAGAGGGCTGAAGG + Intergenic
938370174 2:130763632-130763654 CAGGCTGCCCAGGGGTGGGTGGG - Exonic
938453586 2:131444458-131444480 CAGAGTCCCCAGAGGGCTGAAGG - Intergenic
938461818 2:131502224-131502246 CAGATTCCCCAGAGGGTGGAGGG + Intergenic
938462842 2:131509156-131509178 CAGGCTGCCCAGAGAGAGAGTGG - Intergenic
940437148 2:153668824-153668846 CAGGCTGTCCAGAGGCCTGAGGG + Intergenic
941829990 2:169945462-169945484 GAAGCTGCCCAGATGGCTGAGGG - Intronic
945009728 2:205448165-205448187 ATGGCTGCCAAGAGGGCTGAAGG - Intronic
945319602 2:208406653-208406675 CCCGCAGCCCAGGGGGCGGAGGG - Intronic
945417598 2:209594156-209594178 CAGGCATCCCAGAGGGAGTATGG + Intronic
947593916 2:231399352-231399374 CAGTCTCCCCAGAGGCCGGGCGG + Exonic
947959327 2:234221745-234221767 CAGGCAGCCCAGTGGACTGAGGG + Intergenic
948632529 2:239311230-239311252 CAGGCTGCTGAGAGCTCGGAAGG - Intronic
948771605 2:240253985-240254007 CTGGCTTCCCAGAGGGAGGCAGG + Intergenic
948776752 2:240293199-240293221 CAGTCTGCCGGGAGGGCAGAAGG - Intergenic
948801572 2:240435684-240435706 CGGGCAGCCCAGAGCGCGGCGGG - Exonic
949050164 2:241893495-241893517 CACACTGCCCAGAGGCCAGACGG - Intergenic
949058729 2:241944154-241944176 GTCGCTTCCCAGAGGGCGGAAGG + Intergenic
1169247912 20:4038355-4038377 CAGTCAGCCCAGAGGGCGGGTGG + Intergenic
1169289925 20:4340863-4340885 CAGGCTGCCCACAGTGGTGATGG + Intergenic
1171455770 20:25271301-25271323 GAGGCAGCCCACAGGGCGCAAGG - Intronic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172174190 20:32962229-32962251 CCAGCTGCCAAGAGGGCTGATGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174177995 20:48657060-48657082 CAGGAGGCGCAGAGGGCGGCGGG + Exonic
1174304103 20:49603004-49603026 CAGGATGCCCAGAGGTGGGCTGG - Intergenic
1175570242 20:60012615-60012637 CAAGCTGGCCAGAGAGCTGAGGG - Exonic
1175899451 20:62354301-62354323 CAGGCTGATCAGAGGCCTGAGGG - Intronic
1176023433 20:62974049-62974071 CAGGCTGCCTAGAGTGGGGGGGG - Intergenic
1176040107 20:63060767-63060789 CAGGGTGCCCGGAAGGCGGAAGG + Intergenic
1176097957 20:63352901-63352923 AAGGCTCCCCAGAGGGCGGCTGG - Intronic
1176134874 20:63518122-63518144 CAGGCTTCCCACAGGGCGGGAGG - Intergenic
1176305307 21:5120127-5120149 CTGCCTGCGCAGAGGGCGGCAGG - Intronic
1176382452 21:6120127-6120149 CAGCCTGCCCAGAGCACTGAGGG - Intronic
1177309024 21:19362893-19362915 GAGGCCTCCCAGAGGGTGGAGGG - Intergenic
1178733918 21:35131667-35131689 CAGGCTTCCCTGAGAGCAGATGG + Intronic
1179332302 21:40415729-40415751 CAGGCTCCCCAGGGGGCCGGTGG + Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179741020 21:43418112-43418134 CAGCCTGCCCAGAGCACTGAGGG + Intronic
1179851748 21:44141904-44141926 CTGCCTGCGCAGAGGGCGGCAGG + Intronic
1179989552 21:44940094-44940116 CAGGCTGCCGTGAGGCCGAAAGG + Exonic
1180182047 21:46122424-46122446 AAAGCTGCCCAGAGGGAGGAAGG + Intronic
1180731742 22:17987498-17987520 TAGGCTGCCCAGGGGGCAGAAGG - Intronic
1180783845 22:18536147-18536169 CAGCCTGTCCAGAGTGCGTATGG - Intergenic
1181240745 22:21475499-21475521 CAGCCTGTCCAGAGTGCGTATGG - Intergenic
1181402842 22:22661725-22661747 CAGCCTGCCTGGAGGGCTGAAGG - Intergenic
1181616271 22:24056873-24056895 CAGGCTCCCCAGAGCTGGGAGGG + Intronic
1181711828 22:24696064-24696086 CAGGCACCCCAGAGGGAGGGAGG - Intergenic
1182115759 22:27755386-27755408 CAGGCAGCACAGGGGGCCGAGGG + Intronic
1182443287 22:30376426-30376448 CTGTCTGCCCAGAGGCCTGAAGG - Exonic
1183248546 22:36712032-36712054 CAGGATGGGGAGAGGGCGGAGGG + Intergenic
1183428672 22:37752746-37752768 CAGGGTCCCCGGAGGGCAGAGGG + Intronic
1183487988 22:38099773-38099795 GAGGCTGCGCAGAGGCGGGAGGG - Intronic
1185064314 22:48623146-48623168 CAGGATGCCCTGACGGCGGTGGG + Intronic
1185206416 22:49541546-49541568 CTGGCTGCCCAGCGAGGGGAGGG + Intronic
1185234556 22:49704553-49704575 CTGGCTGCCCAGAGGCCACAGGG - Intergenic
949192474 3:1266912-1266934 CTGGCTTCCCAGAGGTCTGAGGG - Intronic
950452312 3:13072327-13072349 CAGGCTTCCCAGGGGGCAGTGGG - Intronic
950550634 3:13663970-13663992 CAGGCTGCCCCGATGGCTCAGGG + Intergenic
953541986 3:43828429-43828451 CTGGCTGCCCAGAGGGCCAAGGG + Intergenic
953789960 3:45939719-45939741 GAGGCTGACCAGAGGGACGATGG - Intronic
954152112 3:48662768-48662790 GATGGTGCCCAGAGGGCGGCGGG - Exonic
955747572 3:62155070-62155092 CAGACTTGCCAGTGGGCGGAGGG + Intronic
960619506 3:119625080-119625102 GAGACTGGCCAGAGGGCAGAAGG - Intronic
961453769 3:127014431-127014453 CAGGCATCCCACAGGGCGTAGGG - Intronic
961543724 3:127617884-127617906 CAGGCTGCTCTGATGGCAGAAGG - Intronic
963155412 3:142091094-142091116 CAGACTGCCGTGAGGGCTGAGGG - Intronic
963799105 3:149658880-149658902 CAGGCTCCCCGGAGGGCGGCAGG - Intronic
966855794 3:184193162-184193184 CAGGCTGGCAAGAGGACGCATGG - Exonic
966943159 3:184759706-184759728 CAGCCAGCACAGACGGCGGATGG + Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
968488025 4:873590-873612 CAGGCAGCACAAAGGGCAGAAGG - Intronic
968652015 4:1763886-1763908 GAGGCTGCCCAGAGGGCTCTGGG - Intergenic
969058026 4:4414132-4414154 CAGGTTCCCCACAGGGAGGAGGG + Intronic
969447001 4:7250909-7250931 CAGGCTGGCCAGTGGGCGCAGGG + Intronic
969451830 4:7278252-7278274 CAGGCTGCTCAGAGGAGAGAGGG - Intronic
969471668 4:7392726-7392748 CAGGCATCACAGAGGGGGGAGGG + Intronic
969641954 4:8404169-8404191 CCCGCTGCCCTGAGGGCGAAGGG + Intronic
971311063 4:25526073-25526095 CAGGCTGCCCGCAGGCAGGAAGG - Intergenic
972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG + Intronic
973623690 4:52751182-52751204 TCGGCGGCCCAGGGGGCGGACGG - Intronic
974069367 4:57110205-57110227 CAGGCAGCCCAGCGGGGGCAGGG + Exonic
974103601 4:57443420-57443442 CAGGCTGACAAGAGGGCAGGGGG - Intergenic
978903852 4:113983615-113983637 CTGGATGCCCAGAGGTTGGAGGG + Intergenic
979093362 4:116516099-116516121 AAGGCTGCCCTGAGAGCTGAAGG - Intergenic
980097930 4:128512333-128512355 CAGACTGCCCTGAGGGCCAAGGG + Intergenic
981742059 4:148013121-148013143 CAGGCTGCCCTGAAGGTGGGGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985709051 5:1417941-1417963 CATGCTGCCCAAAGGACAGAGGG - Intronic
986024492 5:3837898-3837920 CAGGCTGCCCAGACTGGGGAAGG + Intergenic
986141288 5:5033112-5033134 AAGGCTGCCCAGAAGGCAGCAGG + Intergenic
989326151 5:40197788-40197810 CAGAGTGCCCAGAGGGCCCAGGG - Intergenic
993756877 5:91742660-91742682 CAGGCTCCCTAGAGGGAGCAAGG - Intergenic
997418965 5:133750917-133750939 GAGGCTGCTCAGTGGGCAGAGGG - Intergenic
998132475 5:139658415-139658437 CAGGCTGCCCTGAGGTCACAGGG + Intronic
998671051 5:144354458-144354480 TAGGCTGGCCAGAGGGTGGAAGG - Intronic
999481341 5:151950870-151950892 CAGGCTGGCCAAGGAGCGGAGGG - Intergenic
1000117350 5:158166109-158166131 CCAGCTGCCCAGAGGACCGAGGG + Intergenic
1001632590 5:173187218-173187240 TAGGCTGCCCAGAGGACTCAAGG - Intergenic
1001875261 5:175194824-175194846 CAGGCAGCCCAGAAGGAGGGAGG + Intergenic
1002457573 5:179354281-179354303 CAGGCTGCTGGGAGGGAGGATGG + Intergenic
1002973065 6:2044551-2044573 GGGGCTTCCCAGAGGGTGGAGGG + Intronic
1003778724 6:9398849-9398871 CAGGGTGCCCAGCGAGCGCAGGG + Intergenic
1004465722 6:15883066-15883088 CAGGCTGCAGAGAGGACGGGTGG + Intergenic
1005019325 6:21402422-21402444 CAGGCTGCCCAGAGTCCTGGGGG + Intergenic
1005825860 6:29631655-29631677 CAGGCTCCCCAGTGGGAGGAAGG + Intronic
1005840932 6:29744258-29744280 CAGGCTCACCAGAGGGCACAGGG + Intergenic
1006072440 6:31507287-31507309 CAGGCTCACCAGAGGGCACAGGG - Exonic
1006146842 6:31964393-31964415 GGGGCTGCCCAGAGGGCAGAGGG + Intronic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006411315 6:33875546-33875568 CTGGCTTCCCAGAGGGCCGAGGG + Intergenic
1007293911 6:40806694-40806716 CAGGCTGCACAGAGGGCCTGGGG + Intergenic
1007662751 6:43496579-43496601 CAGGCTGTCCAGACAGAGGAGGG + Intronic
1007775701 6:44223412-44223434 CAGGCGGCCCTGGGGGCGCAGGG + Intronic
1013342206 6:109225825-109225847 GAGGCTGCCCAGAGGGTGAGGGG + Intergenic
1013389265 6:109666776-109666798 CAGCCTGGCCAGAGGTCAGATGG - Intronic
1018030199 6:159835686-159835708 CTGGCTGCCCAGATGGGGTAGGG + Intergenic
1018517040 6:164594624-164594646 CAGGCTGCCCACAGGACACAAGG + Intergenic
1019328741 7:452489-452511 CTGGCTGCCAAGAGTGAGGATGG - Intergenic
1019529166 7:1495076-1495098 CAGGCTGCACAGCGGCCGAACGG + Intronic
1026298811 7:69079344-69079366 CAGTCTACCCGGAGGGCAGAAGG - Intergenic
1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG + Intronic
1028471680 7:91212927-91212949 CATGCTGCACAGATGGCGTAAGG + Intergenic
1029271487 7:99379747-99379769 CAGGCTGCCCAGCGGCGGGGTGG - Intronic
1029403234 7:100358171-100358193 GAGGCTCCCCAGAGGGCTGTGGG - Intronic
1029453650 7:100656251-100656273 CGGGGTGCCCAGAGCTCGGATGG + Intronic
1029550064 7:101232790-101232812 CCCGCTGCCCCGAGGGCGGGGGG + Intronic
1032420948 7:131778635-131778657 CAGGATGGCCAGAGGGCCTAGGG - Intergenic
1033244545 7:139707092-139707114 CAGGCTCCTCAGAGGTGGGACGG + Intronic
1035682507 8:1498239-1498261 CAGGCTGCAAAGAGGATGGATGG + Intergenic
1035716036 8:1755609-1755631 CGGTCTGCCCAGAGGGCTGGGGG + Intergenic
1037564480 8:20105935-20105957 AAGGCTGCACAGAGGGAGAAGGG + Intergenic
1038049864 8:23798457-23798479 CAGGCTCCCCAGAGGGCTCGAGG + Intergenic
1039308888 8:36294363-36294385 CAAGCTGTCCAGAGAGCAGAGGG + Intergenic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1039826154 8:41175643-41175665 CAGGCTGCCCTGAGGTTAGAAGG + Intergenic
1039894578 8:41707427-41707449 CAGGCTGCCCAGAGGCTTGTGGG + Intronic
1039907635 8:41798196-41798218 CAGCCTCCCCGGGGGGCGGAGGG - Intronic
1045443551 8:102238692-102238714 CAGGCTGCGGCGAGGGCGGGCGG + Intronic
1046171408 8:110512292-110512314 CTGGCTTCCCTGAGGGCTGAGGG + Intergenic
1048604405 8:135952715-135952737 CAGACTGCCCTGTGGGTGGAAGG + Intergenic
1048971520 8:139647592-139647614 CATGCTGGCCAGATGGAGGAGGG + Intronic
1049513692 8:143042715-143042737 CAGGTAGCCCAGAGAGCTGAGGG + Intronic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1053274112 9:36770557-36770579 CAGGCTGGGCAGAGGGGGAAGGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053462584 9:38282021-38282043 GAGGCTGAGCAGAGGGCAGAGGG + Intergenic
1056361567 9:85862739-85862761 CCAGCTGCCCTGAGGGCTGAGGG - Intergenic
1057185272 9:93053958-93053980 CAAGGCGCCCAGAGGGCAGAAGG - Intergenic
1057305691 9:93910821-93910843 CAGGCTGGCCACAGGGTGGCAGG + Intergenic
1057914881 9:99047889-99047911 CAGGCTGGTCTGTGGGCGGAGGG + Intronic
1059329118 9:113524059-113524081 CAGCCTGACCACAGGGCGGTGGG + Intronic
1060983571 9:127807365-127807387 GAGGGTGCCCAGAGGCCGCATGG - Intronic
1061371939 9:130202224-130202246 CAGGCTGGCCAGAGGGTAAAGGG - Intronic
1061626656 9:131844382-131844404 CTCGGTGGCCAGAGGGCGGAGGG + Intergenic
1061798354 9:133101338-133101360 AAGGCTGGCCTGAGGGCAGAGGG - Intronic
1061812115 9:133168163-133168185 CAGGCTCCCCTGAGAGCAGAAGG + Intergenic
1061873653 9:133533560-133533582 CAAGCTGGACAGAGGGCAGACGG + Intronic
1062630653 9:137461706-137461728 GAGGCTGCAGAGAGGGCGCAGGG - Intronic
1062701321 9:137905906-137905928 GAGGCAGCCCAGAGGGCACAAGG - Intronic
1188526710 X:31095245-31095267 AAGGCTGCCCAGGGGAGGGAGGG + Intergenic
1189494937 X:41500139-41500161 CAGGCTTCCCACAGGGTGGGAGG - Intergenic
1190896525 X:54624033-54624055 CCGGCTACTCAGAGGGCTGAGGG - Intergenic
1191994255 X:67073930-67073952 CAGGCTTTTCAGAGGGTGGAGGG + Intergenic
1192698903 X:73447339-73447361 CAGGCGGCACAGGGGGCGGTGGG + Exonic
1196441461 X:115723203-115723225 CTGGCTGCCCAGAAGCCGGAGGG - Intergenic
1196444991 X:115841192-115841214 CTGGCTGCCCAGAAGCCGGAGGG - Intergenic
1196818736 X:119686171-119686193 CAGGCTCCCCAGAGGGCAGTTGG - Intronic
1199778578 X:151037568-151037590 CAGGAAGCCCAGTGGGCAGAAGG + Intergenic
1199829225 X:151532337-151532359 CAGTATGCCAAGAGGGCTGAGGG + Intergenic
1200043081 X:153384081-153384103 GAGGCTGCCCACAGGGGGAAAGG + Intergenic
1200096713 X:153667985-153668007 GAGGCTGCCCAGGGTGCTGAAGG + Intergenic
1200125105 X:153809780-153809802 CAGGCTGCCCGGTGGCCAGAAGG + Intronic
1200181297 X:154152100-154152122 CAGGCTTCCCAGATGGCCAAGGG - Intronic
1200186943 X:154189214-154189236 CAGGCTTCCCAGATGGCCAAGGG - Intergenic
1200192593 X:154226352-154226374 CAGGCTTCCCAGATGGCCAAGGG - Intronic
1200198348 X:154264156-154264178 CAGGCTTCCCAGATGGCCAAGGG - Intronic
1200954926 Y:8934514-8934536 CAGGCTGCCAACAGGGATGAAGG - Intergenic
1202379426 Y:24262530-24262552 CAGGCTGACAAGCAGGCGGATGG - Intergenic
1202491356 Y:25407591-25407613 CAGGCTGACAAGCAGGCGGATGG + Intergenic