ID: 937957350

View in Genome Browser
Species Human (GRCh38)
Location 2:127428786-127428808
Sequence CAGGAACCAGGTGCCGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937957350_937957366 27 Left 937957350 2:127428786-127428808 CCTTCCACGGCACCTGGTTCCTG 0: 1
1: 0
2: 1
3: 18
4: 185
Right 937957366 2:127428836-127428858 TGTGGGCTCCTTCACAACTACGG 0: 1
1: 0
2: 0
3: 7
4: 109
937957350_937957364 9 Left 937957350 2:127428786-127428808 CCTTCCACGGCACCTGGTTCCTG 0: 1
1: 0
2: 1
3: 18
4: 185
Right 937957364 2:127428818-127428840 GTGAGCTGGGGTGAGGGCTGTGG 0: 2
1: 0
2: 11
3: 142
4: 1402
937957350_937957360 -3 Left 937957350 2:127428786-127428808 CCTTCCACGGCACCTGGTTCCTG 0: 1
1: 0
2: 1
3: 18
4: 185
Right 937957360 2:127428806-127428828 CTGGTGGGCCTGGTGAGCTGGGG 0: 1
1: 1
2: 5
3: 37
4: 483
937957350_937957362 3 Left 937957350 2:127428786-127428808 CCTTCCACGGCACCTGGTTCCTG 0: 1
1: 0
2: 1
3: 18
4: 185
Right 937957362 2:127428812-127428834 GGCCTGGTGAGCTGGGGTGAGGG 0: 1
1: 0
2: 4
3: 68
4: 524
937957350_937957357 -5 Left 937957350 2:127428786-127428808 CCTTCCACGGCACCTGGTTCCTG 0: 1
1: 0
2: 1
3: 18
4: 185
Right 937957357 2:127428804-127428826 TCCTGGTGGGCCTGGTGAGCTGG 0: 1
1: 2
2: 3
3: 41
4: 346
937957350_937957359 -4 Left 937957350 2:127428786-127428808 CCTTCCACGGCACCTGGTTCCTG 0: 1
1: 0
2: 1
3: 18
4: 185
Right 937957359 2:127428805-127428827 CCTGGTGGGCCTGGTGAGCTGGG 0: 1
1: 1
2: 9
3: 44
4: 340
937957350_937957365 10 Left 937957350 2:127428786-127428808 CCTTCCACGGCACCTGGTTCCTG 0: 1
1: 0
2: 1
3: 18
4: 185
Right 937957365 2:127428819-127428841 TGAGCTGGGGTGAGGGCTGTGGG 0: 1
1: 1
2: 8
3: 100
4: 681
937957350_937957361 2 Left 937957350 2:127428786-127428808 CCTTCCACGGCACCTGGTTCCTG 0: 1
1: 0
2: 1
3: 18
4: 185
Right 937957361 2:127428811-127428833 GGGCCTGGTGAGCTGGGGTGAGG 0: 1
1: 0
2: 9
3: 93
4: 1018

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937957350 Original CRISPR CAGGAACCAGGTGCCGTGGA AGG (reversed) Exonic
900405622 1:2491756-2491778 AAGGAACCAGGAGCTGTGGCCGG + Intronic
900805370 1:4763930-4763952 CAAGAACCAGGAACCTTGGAAGG - Intronic
902166582 1:14576881-14576903 CAGGAACCAGGTGGTATGGGAGG - Intergenic
904011867 1:27394482-27394504 CAGGCAGCAGGTGCCGCTGAAGG - Exonic
904332198 1:29767373-29767395 CAGGACCCTGGAGCCGCGGAAGG + Intergenic
904392641 1:30196029-30196051 CAGGACCCGGGTGCCAGGGAGGG + Intergenic
904942934 1:34177495-34177517 CAGGAACCAGGCGCCTGGGCGGG - Intronic
905310071 1:37042994-37043016 CAGGAACCAGGTGATGGGGATGG + Intergenic
906000485 1:42420441-42420463 CAGGGACCACGTGGAGTGGAAGG - Exonic
906091287 1:43181453-43181475 CAGGAACCAGGCACTGTGGTGGG - Intronic
907682762 1:56579382-56579404 AAGGAACCAGCTGCGGAGGAAGG - Exonic
912719190 1:112005425-112005447 CAGGAAGAAGGTGCAGAGGAGGG + Intergenic
912801092 1:112720125-112720147 CAGGAAGCAGGTGCCATAGTGGG + Intergenic
917524430 1:175774574-175774596 CTGGATTCAGGTGCCCTGGAAGG - Intergenic
920135321 1:203764617-203764639 CAGCAGCCAGGAGCTGTGGAAGG + Intergenic
920550404 1:206855851-206855873 CCAGAACCAGGTCCCATGGAAGG + Intergenic
922936389 1:229426257-229426279 CAGGCACCAGGCACCGTGTAGGG + Intergenic
923714785 1:236415730-236415752 CAGGGCCCAGGTGCAGTGGGTGG - Intronic
923732070 1:236561367-236561389 CAGAAAACAGTTGCTGTGGAAGG - Intronic
1063379357 10:5574743-5574765 CATGAACCAGGTGCAGGGGAGGG - Intergenic
1063619656 10:7634419-7634441 CCAGAGCCAGGTGCAGTGGACGG - Intronic
1064446559 10:15398919-15398941 AAGGAACCAGTTGCCATGAAGGG + Intergenic
1066480658 10:35792505-35792527 CAGAAACCAGCTGTCCTGGATGG - Intergenic
1067580557 10:47442872-47442894 CAGGAACCAGGGCCCGAGCAGGG + Intergenic
1068601976 10:58966219-58966241 CAGGCACCAGGTGGCCTTGATGG - Intergenic
1069807079 10:71132762-71132784 CAGGAAGCAGGTGCCATGGAGGG - Intergenic
1070662961 10:78320661-78320683 CAGCAATCATGTGCCCTGGACGG + Intergenic
1072612427 10:97027110-97027132 CAGGAACCAGGAACACTGGATGG + Intronic
1073326616 10:102647053-102647075 CAGGAGACAGGTGCATTGGAGGG - Intronic
1074047162 10:109849733-109849755 CATGAACCAGGTGCCCAGGATGG + Intergenic
1076116499 10:127905442-127905464 AAGGAACCAGGTGCACTGGTTGG + Intergenic
1076768595 10:132651102-132651124 CAGGCACCAGGTGTCTGGGAAGG + Intronic
1077011567 11:381365-381387 CAGGAACCCGGGGCCGGGGGCGG - Intronic
1077011596 11:381429-381451 CAGGAACCCGGGGCCGGGGGCGG - Intronic
1077011625 11:381493-381515 CAGGAACCCGGGGCCGGGGGCGG - Intronic
1077011654 11:381557-381579 CAGGAACCCGGGGCCGGGGGCGG - Intronic
1077496985 11:2891183-2891205 TAGGAAGCAGGTACCGAGGAGGG + Intronic
1078518473 11:12044946-12044968 CAGGAACCCTGTGCCAGGGATGG - Intergenic
1078594511 11:12674726-12674748 CAGGGACCGGGAGCCGGGGAGGG + Exonic
1079021368 11:16911891-16911913 AATTAAGCAGGTGCCGTGGACGG - Intronic
1079200903 11:18376558-18376580 GAGGTACCAGGTACCATGGAAGG - Intergenic
1081698508 11:45136611-45136633 CAAGAACCAGGTCCCTTAGAAGG + Intronic
1083924685 11:65798722-65798744 CAGGAAGCAGGGGCAGTGTAGGG + Intergenic
1084172717 11:67408396-67408418 CAGGAAGCTGGTGGCTTGGAGGG + Intronic
1084209851 11:67615894-67615916 CAGGAAGCACGTGCCATGGGTGG - Intergenic
1091897680 12:4118164-4118186 CAGCAGCCAGCTGCCTTGGATGG + Intergenic
1091918972 12:4289396-4289418 CAGGACTCAGCTGCAGTGGATGG + Intronic
1092899417 12:13044553-13044575 CAGGCGCCCGGTGCCGAGGAGGG + Intronic
1094046109 12:26168653-26168675 CAGGAAGAAGGTTTCGTGGAGGG + Intronic
1095184944 12:39190506-39190528 CATGAACCAGATGCCAAGGAAGG - Intergenic
1095671867 12:44870976-44870998 CAGGAACCAGGTTACATGGTAGG - Intronic
1097345627 12:58488877-58488899 CAGGAACAATGTGCCATGGGTGG - Intergenic
1102263598 12:111461674-111461696 AAGGAACCAGGGGCCGAGGTAGG + Intronic
1104104912 12:125650122-125650144 CAGGAACCATCAGCAGTGGACGG - Intronic
1104897112 12:132169718-132169740 CAGGACCCAGGTGCCATGGGAGG - Intergenic
1105826158 13:24125412-24125434 CAGGAACCAGGGGGCATGGAGGG + Intronic
1107770822 13:43786559-43786581 CTAGATCCAGGTGCCGTGGCGGG + Intronic
1111337448 13:86841072-86841094 CAGGAACTTGGTGCTGTCGATGG + Intergenic
1113088807 13:106595876-106595898 CAGGCACCAGGCCCAGTGGAAGG + Intergenic
1117994982 14:61470019-61470041 CAGGGAGCAGCTGCCATGGAGGG - Intronic
1118610280 14:67533922-67533944 CAGGAACCAGGGGCCTTAGTGGG + Intronic
1119718451 14:76875035-76875057 CAAGAAGCAGGTGTCCTGGAGGG + Intergenic
1120647975 14:87096472-87096494 CTTGAACCAGCTGCCGAGGAGGG + Intergenic
1122066281 14:99176128-99176150 CAGGAACCACGCGCTGTTGAAGG + Exonic
1122232691 14:100314771-100314793 CAGGCAGGAGGTGCCTTGGAGGG - Intergenic
1123154439 14:106210804-106210826 CAGGGACCAGGTGCCCAGGGAGG - Intergenic
1123739749 15:23225731-23225753 CCGGATCCAGGGGCCGTGGACGG - Intergenic
1124290974 15:28454704-28454726 CCGGATCCAGGGGCCGTGGACGG - Intergenic
1124648382 15:31456737-31456759 GAGGAGCAAGGTGCAGTGGATGG - Intergenic
1129388037 15:75206704-75206726 CAGGAAGCCCGTGCTGTGGATGG - Exonic
1129658809 15:77541826-77541848 GAGGAACCAGATGCTGAGGAGGG - Intergenic
1130332913 15:82935253-82935275 CAGGAGCCAGGTGGGTTGGAAGG - Intronic
1131107975 15:89747532-89747554 CAGGCCCCACGTGCCGTGGAGGG - Intergenic
1131514220 15:93066531-93066553 CAGAAAGCAGGTGGCGGGGAGGG - Intronic
1132618395 16:853246-853268 ATGGCTCCAGGTGCCGTGGATGG + Intergenic
1134129690 16:11640879-11640901 CAGGAACAAGGTCCCGTGTGTGG + Intergenic
1134527636 16:14956650-14956672 CAGGCACCAGGGGCCGGGCATGG + Intergenic
1134914856 16:18060926-18060948 CAGGAAGCAGGTGTCTTGGCGGG - Intergenic
1135068916 16:19335341-19335363 CAGGAACCAGAAGGGGTGGACGG + Intergenic
1136531959 16:30875811-30875833 CGGGAACCAAGTGCAGAGGATGG - Intronic
1138460411 16:57144361-57144383 CAGGAACAAGGCACCCTGGAAGG + Intronic
1140103006 16:71934673-71934695 CAGCAACCAGGTTACTTGGAAGG + Intronic
1141797837 16:86286773-86286795 CTGGACCCAAGTCCCGTGGAAGG - Intergenic
1142623382 17:1178839-1178861 CAGGAGCAAGGTGCGGTGGTGGG + Intronic
1142623855 17:1180255-1180277 CGCAAACCAGGTGCCGTGGGGGG + Intronic
1142764043 17:2056014-2056036 CAGGAAGCAGGTGGGGGGGAGGG - Intronic
1142893115 17:2957876-2957898 CAGAAGCCGGGTGCCCTGGACGG + Intronic
1143034881 17:3989085-3989107 GAGGAACCAGGTGCAGCGGGAGG - Intergenic
1146522557 17:33537400-33537422 CAGGAAGCACGTGCTGTGGCAGG - Intronic
1148540612 17:48477490-48477512 CAGGAGGCAGGAGCCGTGGGAGG - Intergenic
1148805008 17:50259620-50259642 CAGGGATCAGGTGCCAGGGAAGG - Intergenic
1150488318 17:65559243-65559265 TGGGAACCAGATGCCGGGGAAGG - Intronic
1151716297 17:75832807-75832829 CAGGAAAGAGGGGCCGTGGGAGG + Intronic
1151716328 17:75832897-75832919 CAGGAAGGAGGGGCCGTGGGAGG + Intronic
1152123992 17:78435402-78435424 CAGGGACCAGTTGCCTCGGAGGG - Intronic
1152568801 17:81112264-81112286 CAGGGACCACGTCCCTTGGAGGG + Intronic
1153807397 18:8721337-8721359 CCGGAACCAGGTGCAGCAGATGG - Intronic
1155498417 18:26464655-26464677 TAGGTGCCAGATGCCGTGGAAGG + Intronic
1157806933 18:50665300-50665322 CAGGAACCCGGGGCAGGGGAAGG - Intronic
1160434791 18:78841487-78841509 CAGCAACTAGGTGACGTGGAGGG + Intergenic
1160512638 18:79461127-79461149 CAGGAGCCACGTGCCCTGGCAGG - Intronic
1164751015 19:30654727-30654749 CAGGAACCCAGTGCCCTGGAAGG + Intronic
1167356022 19:49004631-49004653 CTGGAACCAAGTGCAGAGGATGG - Intronic
1167714206 19:51130734-51130756 CAGGATCCAGGAGCCATGGATGG - Intronic
925976929 2:9148230-9148252 GAGGAACCAGCTGCCAGGGAAGG - Intergenic
929215101 2:39403982-39404004 AAGGAACCAGCTGCCTTGAAGGG + Intronic
932510921 2:72289216-72289238 CAGGAACAAGGGGCCTTTGAGGG + Intronic
934474647 2:94586302-94586324 CTGGCACCAGGTTCCATGGATGG - Intergenic
934515043 2:94981155-94981177 CAGGGAGCTGGTGCTGTGGAAGG - Intergenic
935587322 2:104813289-104813311 CCAGAGCCAGGTGCCGTGAATGG - Intergenic
937957350 2:127428786-127428808 CAGGAACCAGGTGCCGTGGAAGG - Exonic
945779327 2:214148552-214148574 CAGGGACCAGGTGAAGTTGATGG - Intronic
947875793 2:233467554-233467576 CAGGAACCAGCAGCCCAGGAGGG - Intronic
948736329 2:240008737-240008759 CAGGAGCCAGGTGCTGTGTGGGG + Intronic
948793417 2:240390638-240390660 CAGGCAGCAGGAGCCGTGCACGG + Intergenic
948818339 2:240525407-240525429 CAGGAAAGGGGTGCTGTGGAGGG - Intronic
948921143 2:241066470-241066492 CAGGAACCAAGTGGGGTGCAGGG + Intronic
1172331472 20:34078745-34078767 GAGGAAGCAGGTGCCGTAGATGG + Intronic
1173058077 20:39635766-39635788 CCAGGACCAGGTGCCCTGGAGGG - Intergenic
1175714658 20:61247359-61247381 CAGGGAACAGGTGCAGAGGACGG + Intergenic
1175764329 20:61582300-61582322 CATGAGCCAGGTGCCCTGCACGG + Intronic
1178015074 21:28335452-28335474 CAGGAATCAGCTTCAGTGGAGGG - Intergenic
1178825906 21:36016748-36016770 CAGGAATCAGGGGCCGGGCACGG + Intergenic
1179881134 21:44293779-44293801 CAGGAGCCAGGTTCTGTGGGAGG - Exonic
1182249967 22:28992374-28992396 CTGGAGTCAGGTGCTGTGGAAGG - Intronic
1182351591 22:29702954-29702976 GTGGAACCAGGTGCCCTGCAGGG + Intergenic
1183120878 22:35729043-35729065 AAGGCACCAGGTGGCGTGGCAGG - Intronic
1184094985 22:42311579-42311601 CAGGAGCAAGGTGCAGTTGAAGG + Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
954404978 3:50340661-50340683 CAGGGACCAGCTGCCGTGTGGGG + Exonic
954610332 3:51941701-51941723 CGGGACCCAGGTCCCCTGGATGG + Intronic
955006418 3:54972904-54972926 CAGGCACCAGGTGCCTAAGAAGG - Intronic
962494638 3:135926858-135926880 CTGGCACCAGGTGGTGTGGAGGG - Intergenic
962590401 3:136884196-136884218 CCAGAAGCAGGTGGCGTGGAGGG + Intronic
962887155 3:139638277-139638299 CAGGAATCAGGGTCCTTGGATGG - Intronic
967017715 3:185496828-185496850 CAGGAAGCTGGAGCCGGGGATGG + Exonic
968727954 4:2256899-2256921 CAGGACCCAGGAGCCGGGGCAGG - Intronic
969344716 4:6563600-6563622 CAGGCACCAGGAGCCCTGGTCGG + Intronic
969419360 4:7082807-7082829 CAGGAACAAGGGGCCGGGCATGG - Intergenic
971261546 4:25061785-25061807 CATGCACCAGGTGCCGACGATGG + Intergenic
984717075 4:182935902-182935924 TAGAAACCAGGTGCCCTGGTTGG + Intergenic
985718302 5:1475379-1475401 CAGGGACCAGGAGCCCTGGCTGG + Intronic
986586351 5:9322066-9322088 CCGGAAGCAGGTGTTGTGGATGG - Intronic
986723437 5:10577021-10577043 GAGGAAGCTGGTGCCGGGGATGG + Intronic
987033630 5:13998227-13998249 CAGCAACAAGGTGCCATGGATGG - Intergenic
987666602 5:20949938-20949960 CGGGAACCAGGTGCCTGGGTAGG - Intergenic
989129959 5:38097708-38097730 CAGGACCCAGGACCCGTGGCTGG + Intergenic
991437874 5:66614997-66615019 CAGGAACCAGGACCCTTGTAAGG + Intronic
992773418 5:80069745-80069767 CAGGAACCAGGAGCCCGGGAGGG + Intronic
992994537 5:82319472-82319494 CAGGAAACATGTGCAGTGGAGGG + Intronic
994656840 5:102604677-102604699 CAGGACCCAGGTGGTCTGGATGG - Intergenic
996462000 5:123755749-123755771 CAGGACCCATTTGACGTGGATGG - Intergenic
997034626 5:130174869-130174891 CTGGAGCCAGATGCCATGGATGG - Intronic
997670329 5:135666126-135666148 CAGGATCCTGGTGTCCTGGATGG - Intergenic
997698064 5:135877310-135877332 AAGGAAGCAGCTGCTGTGGAGGG + Intronic
1001330679 5:170760253-170760275 CAGGAGCCAGCTGAGGTGGAGGG + Intergenic
1001411990 5:171518781-171518803 CAGGAACCCAGGGCCGGGGATGG + Intergenic
1002640363 5:180627877-180627899 CACTGACCAGGTGCCTTGGATGG + Intronic
1004614985 6:17281151-17281173 TAGGAATCAGGTGCCTTGGGTGG - Intergenic
1006132752 6:31878793-31878815 CGGGAACCGGGAGCCATGGAGGG - Intronic
1007663517 6:43501035-43501057 CAGGAGCCAGGAGCTGGGGAAGG - Intronic
1007794166 6:44334241-44334263 CAGGAACAAGGTGGAGAGGATGG + Intronic
1008418409 6:51269699-51269721 CAGGAAGCAGTTGCCCTGCAAGG + Intergenic
1009450286 6:63792056-63792078 AAAGAACCAGGTGCAGTGGCAGG + Intronic
1009657695 6:66567832-66567854 CAGGACCCAGGAACCATGGAGGG - Intergenic
1011270926 6:85579231-85579253 CAAGAGCCAGGTGCCGGGCATGG + Intronic
1017852340 6:158315770-158315792 CAGGAACGAGGTGCCATTTATGG - Intronic
1018845417 6:167552058-167552080 CAGGAAGCAGGTGCTGTGGTGGG + Intergenic
1018954942 6:168403177-168403199 CAGGAACCAAGTGGCCTTGATGG - Intergenic
1019865120 7:3701021-3701043 GAGGAACCAGTTGCCGCGCAGGG + Intronic
1024064229 7:45719179-45719201 CAGGAAGCAGCTGCCCTGGCTGG - Exonic
1026578448 7:71594175-71594197 CAGGGACCAGCTGGGGTGGATGG + Intronic
1033539634 7:142344955-142344977 CAGCAACCAGGCACCGGGGAGGG - Intergenic
1033660892 7:143401292-143401314 CAGGACCCAGATGGCATGGAGGG + Intronic
1035644822 8:1210754-1210776 CAGGATCCACGTGCCCTGCAGGG - Intergenic
1040458937 8:47628158-47628180 CAGGAAGCATGTTCTGTGGAAGG - Intronic
1040526134 8:48226699-48226721 CAGGACCCAGGAACCATGGAGGG + Intergenic
1042395003 8:68281723-68281745 GAACAACCAGGGGCCGTGGAAGG + Intergenic
1043467669 8:80528488-80528510 CAGGGACAAGGTGCGGGGGAAGG - Intergenic
1046046252 8:108968476-108968498 CAGGAACCGAGTGCAGTGCATGG - Intergenic
1047256641 8:123218256-123218278 CAGCAATGAGGTGCTGTGGAAGG + Intergenic
1048265898 8:132985688-132985710 CAGGAAGCAGGTGCTGCAGAGGG - Intronic
1048610067 8:136012534-136012556 CTGGAAAGAGGTGCCGGGGATGG - Intergenic
1048912802 8:139152262-139152284 CAGGACCTGGGTGCCATGGAGGG + Intergenic
1049180332 8:141218956-141218978 CCGGAACCAGCTGCCCAGGAAGG + Exonic
1049519653 8:143081351-143081373 CAGGTGCCAGGTGCCGGGGAAGG + Intronic
1049616038 8:143576143-143576165 CAGGTTCCAGGTGCCCTGGCTGG - Exonic
1049796583 8:144499864-144499886 CAGGAACCTGGATCCCTGGATGG + Intronic
1052104765 9:24499363-24499385 CAGGAATCAGATTCCGTGAAAGG + Intergenic
1052857520 9:33416432-33416454 CAGGCCCCAGGTGCCGGGGCAGG + Intergenic
1059328864 9:113522639-113522661 CAGAGACCAGCTGCCATGGAGGG + Intronic
1060437568 9:123607421-123607443 CAGGGACCAGGAACAGTGGAAGG + Intronic
1060982859 9:127803519-127803541 CAGGAATCAGGGGTAGTGGAGGG + Intronic
1061872168 9:133526941-133526963 CAGGAACGACGTGGCGTGGAGGG - Intronic
1062518190 9:136946414-136946436 CTGGCACCAGGCGGCGTGGAGGG - Intronic
1062536248 9:137022285-137022307 CAGCAACCAGGGGGCGTGGCTGG + Intronic
1189891698 X:45609924-45609946 CAGGAACCTGCTGCATTGGAGGG + Intergenic
1190538931 X:51457602-51457624 CAGGACCCAGGAACCATGGAGGG + Intergenic
1192424211 X:71061027-71061049 CAGGAACTACGTCCCGGGGAAGG - Exonic
1193790858 X:85813814-85813836 CAGTACCCAGGAACCGTGGAGGG + Intergenic
1196928281 X:120655628-120655650 CAGGTACTTGGTGCCCTGGAAGG - Intergenic
1198429203 X:136548824-136548846 CTGGAACCAGGTGCCGAGCGGGG - Exonic
1198847900 X:140932251-140932273 CAGGATCCAAGTCCTGTGGATGG + Intergenic
1200097393 X:153670568-153670590 CAGGAACGAGGTGGCATTGAAGG + Exonic
1200757463 Y:7003392-7003414 AAGGAACGAGATGCTGTGGATGG + Intronic