ID: 937969264

View in Genome Browser
Species Human (GRCh38)
Location 2:127536737-127536759
Sequence CAGAACCCTGCACTTTGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937969258_937969264 28 Left 937969258 2:127536686-127536708 CCCTTCAGGCTCCACTTTGTAAC No data
Right 937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG No data
937969261_937969264 17 Left 937969261 2:127536697-127536719 CCACTTTGTAACCCTGGACTTGA No data
Right 937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG No data
937969259_937969264 27 Left 937969259 2:127536687-127536709 CCTTCAGGCTCCACTTTGTAACC No data
Right 937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG No data
937969263_937969264 5 Left 937969263 2:127536709-127536731 CCTGGACTTGAATTTTGCTCTAA No data
Right 937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG No data
937969262_937969264 6 Left 937969262 2:127536708-127536730 CCCTGGACTTGAATTTTGCTCTA No data
Right 937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG No data
937969257_937969264 29 Left 937969257 2:127536685-127536707 CCCCTTCAGGCTCCACTTTGTAA No data
Right 937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937969264 Original CRISPR CAGAACCCTGCACTTTGTTT AGG Intronic
No off target data available for this crispr