ID: 937970091

View in Genome Browser
Species Human (GRCh38)
Location 2:127542558-127542580
Sequence CATACTATGGATAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937970086_937970091 8 Left 937970086 2:127542527-127542549 CCCCTGTTGACAGTAAAATAAGT No data
Right 937970091 2:127542558-127542580 CATACTATGGATAAGGATGAAGG No data
937970084_937970091 17 Left 937970084 2:127542518-127542540 CCCAGACAACCCCTGTTGACAGT No data
Right 937970091 2:127542558-127542580 CATACTATGGATAAGGATGAAGG No data
937970087_937970091 7 Left 937970087 2:127542528-127542550 CCCTGTTGACAGTAAAATAAGTA No data
Right 937970091 2:127542558-127542580 CATACTATGGATAAGGATGAAGG No data
937970088_937970091 6 Left 937970088 2:127542529-127542551 CCTGTTGACAGTAAAATAAGTAA No data
Right 937970091 2:127542558-127542580 CATACTATGGATAAGGATGAAGG No data
937970085_937970091 16 Left 937970085 2:127542519-127542541 CCAGACAACCCCTGTTGACAGTA No data
Right 937970091 2:127542558-127542580 CATACTATGGATAAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937970091 Original CRISPR CATACTATGGATAAGGATGA AGG Intronic
No off target data available for this crispr