ID: 937971503

View in Genome Browser
Species Human (GRCh38)
Location 2:127552610-127552632
Sequence GACACCAGGATCTGCCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937971503_937971510 4 Left 937971503 2:127552610-127552632 CCTGTGAGGCAGATCCTGGTGTC No data
Right 937971510 2:127552637-127552659 GAGGAATGATGGGGCATGCCTGG No data
937971503_937971507 -7 Left 937971503 2:127552610-127552632 CCTGTGAGGCAGATCCTGGTGTC No data
Right 937971507 2:127552626-127552648 TGGTGTCTGGAGAGGAATGATGG No data
937971503_937971513 23 Left 937971503 2:127552610-127552632 CCTGTGAGGCAGATCCTGGTGTC No data
Right 937971513 2:127552656-127552678 CTGGAGGTCAGATGCTGCAGCGG No data
937971503_937971515 25 Left 937971503 2:127552610-127552632 CCTGTGAGGCAGATCCTGGTGTC No data
Right 937971515 2:127552658-127552680 GGAGGTCAGATGCTGCAGCGGGG No data
937971503_937971511 7 Left 937971503 2:127552610-127552632 CCTGTGAGGCAGATCCTGGTGTC No data
Right 937971511 2:127552640-127552662 GAATGATGGGGCATGCCTGGAGG No data
937971503_937971514 24 Left 937971503 2:127552610-127552632 CCTGTGAGGCAGATCCTGGTGTC No data
Right 937971514 2:127552657-127552679 TGGAGGTCAGATGCTGCAGCGGG No data
937971503_937971508 -6 Left 937971503 2:127552610-127552632 CCTGTGAGGCAGATCCTGGTGTC No data
Right 937971508 2:127552627-127552649 GGTGTCTGGAGAGGAATGATGGG No data
937971503_937971509 -5 Left 937971503 2:127552610-127552632 CCTGTGAGGCAGATCCTGGTGTC No data
Right 937971509 2:127552628-127552650 GTGTCTGGAGAGGAATGATGGGG No data
937971503_937971516 28 Left 937971503 2:127552610-127552632 CCTGTGAGGCAGATCCTGGTGTC No data
Right 937971516 2:127552661-127552683 GGTCAGATGCTGCAGCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937971503 Original CRISPR GACACCAGGATCTGCCTCAC AGG (reversed) Intronic
No off target data available for this crispr