ID: 937972204

View in Genome Browser
Species Human (GRCh38)
Location 2:127559518-127559540
Sequence ACAGCTCTTGCACTTGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937972204 Original CRISPR ACAGCTCTTGCACTTGGGCT AGG Intronic
900380698 1:2382453-2382475 ACAGCTCTGGAGCTTGGGCTCGG - Intronic
900667899 1:3827948-3827970 GCAGCTCTTGCTCATTGGCTCGG - Intronic
904796275 1:33058601-33058623 ACAGCTGTTACTCTAGGGCTCGG - Intronic
905947032 1:41911808-41911830 CCAGCTCTGGCACTAGGGCTGGG - Intronic
907080255 1:51615408-51615430 TCAACCTTTGCACTTGGGCTTGG + Intronic
917236312 1:172895900-172895922 TCACCTTTTGAACTTGGGCTTGG + Intergenic
918066404 1:181105000-181105022 CCAGCTCTTGCCGGTGGGCTGGG - Intergenic
920494646 1:206446180-206446202 TCAGCTCATTCACGTGGGCTTGG - Exonic
921421551 1:214954701-214954723 ACTGCTCCTACACTTGTGCTTGG + Intergenic
922959768 1:229636383-229636405 ACAGCTCTGGCTCTGGGCCTGGG - Exonic
923405600 1:233655943-233655965 ACAGCTCTTTAACTTATGCTTGG + Intronic
1062960934 10:1573322-1573344 ACAGCTGGTGCACATGGGGTGGG - Intronic
1071969091 10:90884542-90884564 ACAGCTGTGGCAGTTGGGATGGG + Intronic
1073097116 10:100986736-100986758 ACTGTGCTTGCACCTGGGCTGGG + Exonic
1074548745 10:114423625-114423647 ACAGCTCTCTCACTTGTGCTAGG + Intergenic
1074867413 10:117553079-117553101 ACAGATGTTGCCCTAGGGCTGGG - Intergenic
1075630030 10:123995224-123995246 GCAGCACTTGAACTTGGCCTTGG + Intergenic
1076235919 10:128863832-128863854 AGAGCTCATGCTCTTGGGCCAGG - Intergenic
1077584950 11:3444037-3444059 ACAGCTCCTGCTGTGGGGCTGGG - Intergenic
1079190635 11:18274107-18274129 ACAGCCCAAGCCCTTGGGCTTGG - Intergenic
1079345438 11:19647619-19647641 CCAGCTCTTGAACCTGGACTTGG + Intronic
1080623746 11:34009463-34009485 AAAGCTCTTGAACCTGGGATGGG + Intergenic
1083421657 11:62556643-62556665 GCAGTGCTTGCACTTGGGCTAGG - Intergenic
1084063923 11:66692700-66692722 ACAGCTTGTCCACCTGGGCTTGG + Exonic
1084241851 11:67826605-67826627 ACAGCTCCTGCTGTGGGGCTGGG - Intergenic
1084830489 11:71765248-71765270 ACAGCTCCTGCTGTGGGGCTGGG + Intergenic
1087142497 11:94778789-94778811 ACATGTCTGGCACCTGGGCTGGG + Intronic
1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG + Intronic
1091095194 11:132814433-132814455 TCAGCTTCTGCCCTTGGGCTGGG - Intronic
1092412095 12:8261299-8261321 ACAGCTCCTGCTGTGGGGCTGGG - Intergenic
1093056334 12:14559576-14559598 ATAGCTCTTGCTCTTGGGGCTGG - Intronic
1098807199 12:75034985-75035007 ACAGCTCTTGGACTGGTACTGGG + Intergenic
1100154312 12:91779195-91779217 GCAGCTCTCACATTTGGGCTGGG + Intergenic
1102530123 12:113540147-113540169 AGAGCTCTGGCAGCTGGGCTGGG + Intergenic
1109056199 13:57552254-57552276 CCAGCTCATGCACTTGGGGTAGG + Intergenic
1109215015 13:59579709-59579731 AGAGCTCTTGGATTTGGGCCTGG - Intergenic
1112884403 13:104151046-104151068 ATAGCTCCTGCCCTTGGACTCGG - Intergenic
1113323305 13:109258660-109258682 ATAGCTTTTGCTCTGGGGCTAGG + Intergenic
1114364598 14:22013009-22013031 AGAGCACTTACACTTGTGCTTGG - Intergenic
1114614822 14:24062756-24062778 ACAGATCCTGCCCTTGGCCTGGG - Exonic
1116521728 14:45856645-45856667 ACAGATCTTGCACTTGTACTGGG + Intergenic
1117780110 14:59223372-59223394 ACAGCTCTTGGGCTGGGCCTTGG - Intronic
1119582900 14:75803681-75803703 AAACATCTTGCACCTGGGCTGGG + Intronic
1120012993 14:79438150-79438172 CCAGCTCTGGCACTTTGCCTGGG + Intronic
1120296362 14:82646857-82646879 AAAGCTCTTGTGCTTGTGCTAGG + Intergenic
1121883752 14:97523996-97524018 TCAGCTGTTGCTCCTGGGCTGGG + Intergenic
1122332969 14:100938697-100938719 ACAGATCTTATTCTTGGGCTAGG + Intergenic
1123816433 15:23984040-23984062 ACAGGGCTTGTACTTGGGATAGG + Intergenic
1124479037 15:30061618-30061640 ATAGCTCTGGAACTTAGGCTGGG + Intergenic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1128765888 15:70250891-70250913 GCAGCCCTTGAACTTGGGCTGGG - Intergenic
1129009172 15:72399179-72399201 AGTGCTTTTGCACTTCGGCTAGG - Intronic
1129068140 15:72926894-72926916 ACCTATCTGGCACTTGGGCTAGG - Intergenic
1130738677 15:86575201-86575223 AAAGTTATTGCACATGGGCTGGG + Intronic
1132607971 16:801358-801380 CCAGCTGCAGCACTTGGGCTCGG + Intergenic
1133385625 16:5367921-5367943 ACACCTCATGCACTTGACCTTGG + Intergenic
1135593851 16:23726483-23726505 ACAGCTCTTTCATTTGGTCAAGG - Intergenic
1138481120 16:57304011-57304033 ACAGCTCTGTCTCTTGGGTTTGG + Intergenic
1138496879 16:57414195-57414217 CCAGCTCTTGCGGGTGGGCTTGG + Intronic
1139673721 16:68509002-68509024 CCAGCCCTTGCTCTGGGGCTTGG + Intergenic
1140778960 16:78276222-78276244 CCAGCTCTTAGACTTGGGGTAGG + Intronic
1141934706 16:87229502-87229524 GCTGCTCTTCCACTTGGGCTGGG - Intronic
1143347815 17:6262680-6262702 CCATCTCTCTCACTTGGGCTTGG - Intergenic
1143899528 17:10163627-10163649 TCAGCTCTTCCACCTGGGTTGGG + Intronic
1144328177 17:14201800-14201822 ACAGCTCGTGAGCTGGGGCTGGG + Intronic
1145998356 17:29117265-29117287 GCAGCTTTGGCACTTGCGCTCGG - Intronic
1148026286 17:44589932-44589954 ACAGATTTTGGACTTGGGTTGGG + Intergenic
1149830422 17:59867088-59867110 AAATCTCTTGCTTTTGGGCTGGG - Intronic
1151937584 17:77272302-77272324 ACACTTCTGGCACTGGGGCTGGG + Intergenic
1152224678 17:79087230-79087252 GCAGCTCCTGCACTCAGGCTGGG - Intronic
1153663531 18:7347700-7347722 AAATCTCTTGCACTTGTGGTAGG + Intergenic
1154304301 18:13218770-13218792 GCTGCTGTTGCACTTAGGCTGGG + Intronic
1155659409 18:28229971-28229993 ACAGATCCTGCACTTCGGGTCGG - Intergenic
1156276741 18:35591008-35591030 ACAGCTCTGCCACTGGGGATAGG + Intronic
1157741688 18:50099014-50099036 TCAGCTCTTGTAGTTGTGCTTGG - Intronic
1159159907 18:64630744-64630766 ACAGCCATTTCACATGGGCTTGG - Intergenic
1164601285 19:29565279-29565301 ACAGCTCTGGCGCATGAGCTGGG + Intergenic
1166827613 19:45619173-45619195 ACAGCTCTTCCACATGGCCCTGG + Exonic
925146478 2:1586363-1586385 AAAGCTCTGCCCCTTGGGCTTGG + Intergenic
925898914 2:8494654-8494676 ACAGCTTTTGCAGTGGGGTTGGG + Intergenic
926069980 2:9879610-9879632 ACAGCTCTTGCTTTAGGGCTTGG - Intronic
928652825 2:33420440-33420462 AAAGCTCTGGCACCTGGGCCGGG + Intergenic
929924691 2:46198514-46198536 ACAACTCATGCACTGGGCCTTGG - Intergenic
930027943 2:47040838-47040860 ACAGAGCTTGGACTTTGGCTTGG + Intronic
932025462 2:68127585-68127607 TCTGCCCTTGCACTTGGGATAGG + Intronic
932343754 2:70982515-70982537 ACAGAGCTTCCACCTGGGCTGGG - Intronic
935626721 2:105177759-105177781 ACATGTCTGGCACCTGGGCTGGG - Intergenic
936163315 2:110100962-110100984 CCAGCTGTGGCACTTGGGGTAGG - Intronic
937972204 2:127559518-127559540 ACAGCTCTTGCACTTGGGCTAGG + Intronic
938169732 2:129064489-129064511 ACAGATCTTGCTGTGGGGCTGGG + Intergenic
941169141 2:162116498-162116520 ATAACTCTTCCATTTGGGCTGGG + Intergenic
942213257 2:173692908-173692930 ACACCTTTTGCACATGGGCAGGG + Intergenic
944185970 2:196949198-196949220 GCTGCGCTTGCACTTGGACTAGG + Intergenic
944442897 2:199760800-199760822 ACAGCACTTGCCTTTAGGCTTGG + Intronic
944873445 2:203937227-203937249 ATAGCTCTGGCATTTGGACTGGG + Intronic
946257002 2:218449886-218449908 GCAGCACTTCCACTGGGGCTAGG + Exonic
946532632 2:220588802-220588824 ACCTCTCTTTCACTAGGGCTGGG + Intergenic
947876959 2:233474040-233474062 AGAGCTCTTAGACCTGGGCTAGG + Intergenic
1168862101 20:1052848-1052870 ACAGCCCTGGCACTGGGGTTGGG - Intergenic
1172097281 20:32466633-32466655 ACAGCTCTTGCTCCTGGGGTGGG + Intronic
1175889548 20:62310222-62310244 ACTGATCTTCCACTTGGGCCAGG - Exonic
1178544481 21:33481209-33481231 ATAGCTCTTATACATGGGCTAGG + Intergenic
1178585240 21:33865919-33865941 GCAGCTCTGGGACTTGGCCTTGG + Intronic
1178847112 21:36183062-36183084 ACAGCTCCTGCACTCTGGCCTGG - Intronic
1179517723 21:41920192-41920214 ACAGCTCCTGGATTTGGGCCTGG + Intronic
1184580328 22:45412956-45412978 ACTGCTCTTGCCCTTGGCCCTGG - Intronic
1185277974 22:49957915-49957937 CCAGCTCTGGCCCATGGGCTGGG + Intergenic
949348570 3:3100138-3100160 CAAGCTCTTGCACCTGGGCCAGG + Intronic
951205912 3:19925845-19925867 ACAGCTCTCCCACTTGCCCTTGG + Intronic
953287745 3:41629292-41629314 ACACTTCTGGCACCTGGGCTGGG + Intronic
956091566 3:65673084-65673106 AGAGCTGTTGCACTTGTGCCTGG + Intronic
961240951 3:125411095-125411117 ACAGTTATTGAATTTGGGCTGGG - Intergenic
961931025 3:130532831-130532853 ACATGTCTGGCACCTGGGCTGGG + Intergenic
966151904 3:176875030-176875052 ACTGCTGTTGCCTTTGGGCTTGG - Intergenic
967175682 3:186862030-186862052 TCAGCTCTTGCTCTGTGGCTGGG - Intergenic
967341589 3:188404858-188404880 AGAGCTCTTGCAATCAGGCTTGG + Intronic
967891734 3:194368755-194368777 ATGGCTCTTGCACTTTGGCAGGG + Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969000145 4:3973880-3973902 ACAGCTCCTGCTGTGGGGCTGGG - Intergenic
969753875 4:9134727-9134749 ACAGCTCCTGCTGTGGGGCTGGG + Intergenic
969875894 4:10135262-10135284 ACAGCTCGTGGTCTAGGGCTTGG + Intergenic
974431344 4:61800551-61800573 ACAGCACTTGCACTGAGGTTAGG - Intronic
977383154 4:96303270-96303292 ACAGCTTTTGCCCTCGGTCTTGG + Intergenic
979119455 4:116878340-116878362 TCAGTTCTTGCAGTTGGGTTGGG + Intergenic
989255095 5:39358029-39358051 ACATGTCTGTCACTTGGGCTGGG - Intronic
989385863 5:40854130-40854152 AGAGCTCTTGCACATGGGATGGG - Exonic
991410304 5:66339060-66339082 ACTGCTCATCCACTGGGGCTTGG + Intergenic
991650506 5:68847769-68847791 ACAGTTTTTGAACTTGAGCTTGG - Intergenic
1004038044 6:11943453-11943475 ACCTCTCTTGCAATTGGGTTGGG - Intergenic
1004844865 6:19629402-19629424 AAAGCTTTTGACCTTGGGCTAGG + Intergenic
1005444919 6:25912668-25912690 TAATCTCTTGCAATTGGGCTAGG + Intergenic
1006913584 6:37579953-37579975 ACAACTCATGCCCTTCGGCTTGG + Intergenic
1007683927 6:43653590-43653612 ACAGCTGTTGCACTTGAACCTGG + Intronic
1008923207 6:56864284-56864306 TTAGCTCATGCAATTGGGCTGGG - Intronic
1010780298 6:79938017-79938039 ACATCACCTGCACTTGGGCATGG - Intronic
1013797558 6:113904362-113904384 GCAGGTTTTGCACTTGAGCTGGG - Intergenic
1018791235 6:167149599-167149621 ACAGATCCTGAGCTTGGGCTCGG - Intronic
1018904153 6:168065347-168065369 ACCTCTCCTGCACTGGGGCTTGG - Intronic
1019387232 7:764173-764195 GCAGCTCTTCCACTTGGCCCGGG + Intronic
1019532882 7:1512426-1512448 ACAGAAATGGCACTTGGGCTGGG - Intergenic
1019626363 7:2017905-2017927 ACAGCCCTTGGGCCTGGGCTTGG + Intronic
1022235324 7:28455238-28455260 ACAGCTCCTGCAGTTCGGCTCGG - Intronic
1022495005 7:30847382-30847404 AGAGATCTTGCTCTTGGGCAGGG - Intronic
1022786777 7:33645893-33645915 AGAGCTTTTGCTCTTTGGCTGGG - Intergenic
1022995359 7:35749797-35749819 ACAGCTGATGTACATGGGCTTGG + Intergenic
1025992049 7:66503990-66504012 CCAGCACTTGCACTTGGGCCAGG - Intergenic
1030080885 7:105776708-105776730 ACAGCACTTGAATTTGGGATTGG + Intronic
1032845970 7:135752272-135752294 TTAGCTTTTGGACTTGGGCTGGG + Intergenic
1033774122 7:144587893-144587915 ACTGCCTTTGCAGTTGGGCTGGG + Intronic
1034353625 7:150433630-150433652 ACAGTTCTAGCATTTGGGATTGG + Intergenic
1036377090 8:8210076-8210098 ACAGCTCCTGCTGTGGGGCTGGG + Intergenic
1036852458 8:12213073-12213095 ACAGCTCCTGCTGTGGGGCTGGG - Intergenic
1036873826 8:12455596-12455618 ACAGCTCCTGCTGTGGGGCTGGG - Intergenic
1036997225 8:13672451-13672473 ACAGTTCATGCACATAGGCTAGG + Intergenic
1038334473 8:26635152-26635174 CCAGCTCTTGCACGGGGGCTGGG - Intronic
1044312670 8:90711941-90711963 ACAGTTCGTGGACTTGGGGTTGG + Intronic
1045835153 8:106511767-106511789 TCAGCTCTTACACTTGGGCAAGG - Intronic
1048666993 8:136673344-136673366 ATAGCTCTTGCTGTTTGGCTTGG + Intergenic
1050644984 9:7709889-7709911 GCATCTCTTGCACTTGGGTGTGG - Intergenic
1051588028 9:18747775-18747797 CTAGCCCTTGAACTTGGGCTGGG - Intronic
1052099601 9:24429208-24429230 ACAGCTTTTGCACATGGTTTTGG - Intergenic
1053006756 9:34609968-34609990 ACAGTTGTTGCATTTGGGATAGG + Intergenic
1053314202 9:37037737-37037759 ACGACTCTGGCACTGGGGCTCGG + Intergenic
1054737098 9:68765495-68765517 ATAGCTCTGGCACTTCTGCTTGG - Intronic
1055439358 9:76323340-76323362 ACAGCTCTGGCGCTGGGGCTGGG - Intronic
1057903761 9:98968759-98968781 TCAGCTCCTGCAGTTGGGCCTGG + Intronic
1060110135 9:120901068-120901090 ACAGGGCTTGCCCTTTGGCTGGG + Intergenic
1060557796 9:124518094-124518116 ACAACTTTTGTTCTTGGGCTTGG + Exonic
1061195844 9:129106720-129106742 AGAGCTCTAGCCCTGGGGCTTGG - Intronic
1186680699 X:11870623-11870645 ACAGCTCTTGCAGTTTGGTTGGG - Intergenic
1187127902 X:16470972-16470994 ACAGAACCTGCCCTTGGGCTGGG - Intergenic
1192191826 X:68995784-68995806 TGAGCTGTTGCACTTGTGCTTGG - Intergenic
1195763482 X:108272026-108272048 ACAGGGGTTGCACTTGGGCTTGG - Intronic
1196110467 X:111941626-111941648 ACAGCTGTTCTACTTGGTCTAGG + Intronic
1199774435 X:150998404-150998426 ACTGCTCTTGCAATTCAGCTGGG - Intergenic
1199837505 X:151606632-151606654 ACAGGTCTTGGATTTGGGCAAGG - Intronic
1200173149 X:154093902-154093924 ACACCCCTAGCTCTTGGGCTAGG + Intronic
1200213314 X:154356534-154356556 ACAGGCCTGGCACTTGGGCGAGG - Intronic