ID: 937972377

View in Genome Browser
Species Human (GRCh38)
Location 2:127560590-127560612
Sequence ACAGGCCTTGAGAAGCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937972372_937972377 -4 Left 937972372 2:127560571-127560593 CCTGCCCTGGGAGGCAGGGACAG No data
Right 937972377 2:127560590-127560612 ACAGGCCTTGAGAAGCCTGGCGG No data
937972364_937972377 10 Left 937972364 2:127560557-127560579 CCCTGGGGAACTGCCCTGCCCTG No data
Right 937972377 2:127560590-127560612 ACAGGCCTTGAGAAGCCTGGCGG No data
937972371_937972377 -3 Left 937972371 2:127560570-127560592 CCCTGCCCTGGGAGGCAGGGACA No data
Right 937972377 2:127560590-127560612 ACAGGCCTTGAGAAGCCTGGCGG No data
937972375_937972377 -9 Left 937972375 2:127560576-127560598 CCTGGGAGGCAGGGACAGGCCTT No data
Right 937972377 2:127560590-127560612 ACAGGCCTTGAGAAGCCTGGCGG No data
937972365_937972377 9 Left 937972365 2:127560558-127560580 CCTGGGGAACTGCCCTGCCCTGG No data
Right 937972377 2:127560590-127560612 ACAGGCCTTGAGAAGCCTGGCGG No data
937972374_937972377 -8 Left 937972374 2:127560575-127560597 CCCTGGGAGGCAGGGACAGGCCT No data
Right 937972377 2:127560590-127560612 ACAGGCCTTGAGAAGCCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937972377 Original CRISPR ACAGGCCTTGAGAAGCCTGG CGG Intronic
No off target data available for this crispr