ID: 937974394

View in Genome Browser
Species Human (GRCh38)
Location 2:127573441-127573463
Sequence GCTGTTGGCACTCCCCATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937974390_937974394 -8 Left 937974390 2:127573426-127573448 CCCTGGCCTGGACACGCTGTTGG No data
Right 937974394 2:127573441-127573463 GCTGTTGGCACTCCCCATGCCGG No data
937974389_937974394 -1 Left 937974389 2:127573419-127573441 CCGTGTGCCCTGGCCTGGACACG No data
Right 937974394 2:127573441-127573463 GCTGTTGGCACTCCCCATGCCGG No data
937974387_937974394 5 Left 937974387 2:127573413-127573435 CCACTTCCGTGTGCCCTGGCCTG No data
Right 937974394 2:127573441-127573463 GCTGTTGGCACTCCCCATGCCGG No data
937974392_937974394 -9 Left 937974392 2:127573427-127573449 CCTGGCCTGGACACGCTGTTGGC No data
Right 937974394 2:127573441-127573463 GCTGTTGGCACTCCCCATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937974394 Original CRISPR GCTGTTGGCACTCCCCATGC CGG Intronic
No off target data available for this crispr