ID: 937974860

View in Genome Browser
Species Human (GRCh38)
Location 2:127576528-127576550
Sequence TCTGAGGCCCTGAGGCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937974846_937974860 28 Left 937974846 2:127576477-127576499 CCTGGCTGAGAGATGTGGAGCGG 0: 1
1: 0
2: 1
3: 14
4: 210
Right 937974860 2:127576528-127576550 TCTGAGGCCCTGAGGCCTCAGGG 0: 1
1: 0
2: 2
3: 28
4: 337
937974856_937974860 2 Left 937974856 2:127576503-127576525 CCAGGGCTGGGCTGGGCAGAGGC 0: 1
1: 3
2: 20
3: 170
4: 1066
Right 937974860 2:127576528-127576550 TCTGAGGCCCTGAGGCCTCAGGG 0: 1
1: 0
2: 2
3: 28
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937974860 Original CRISPR TCTGAGGCCCTGAGGCCTCA GGG Intronic
900129820 1:1082643-1082665 TCTGAAGCTCTGAGGTCTCATGG + Exonic
901035707 1:6334786-6334808 TCTGAGGCCCAGAGACGTCTAGG + Intronic
901193677 1:7427806-7427828 TCTGAGGGGCTGAGTGCTCAGGG - Intronic
901460572 1:9388859-9388881 GCTGAGGCCCAGAGGGTTCAAGG + Intergenic
902187624 1:14737202-14737224 ACGGAGACCCTGAAGCCTCAGGG + Intronic
904490712 1:30857257-30857279 TCAGAGGCCCTCAGGCCACCTGG + Intergenic
905576250 1:39047031-39047053 TCTGAGGTACTCAGGCCTCTGGG - Intergenic
907032829 1:51189071-51189093 TCTGAGGTCCTGAAACCTCTAGG + Intergenic
907276880 1:53321664-53321686 TGTGAGTCCCTTGGGCCTCAGGG - Intronic
907472814 1:54685451-54685473 TCTGAGGCCCAGAGGCGCCAGGG + Intronic
907558993 1:55371199-55371221 TCTGAGGCCATGAAGCATGAGGG + Intergenic
908859295 1:68465050-68465072 CCTGAGGCGCTGAAGCCTCAGGG + Intergenic
912164526 1:107027131-107027153 GCAAAGGCCCTGAGGCATCATGG + Intergenic
912889179 1:113509947-113509969 TCTGATGCTCTGAGGCTTCTGGG - Intronic
913230082 1:116734458-116734480 TCTGAGGCCCAGAGACATCCAGG + Intergenic
914450529 1:147787573-147787595 CTGGAGGCCCTGCGGCCTCAAGG + Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
918683426 1:187384348-187384370 TCTGTGCCCTTGAGCCCTCACGG + Intergenic
920070499 1:203299426-203299448 TCTGAGGTCCTGATACCTCCGGG + Intergenic
920344281 1:205295912-205295934 TCAGAGGCACTTAGGCCTCCAGG - Intergenic
921127348 1:212189432-212189454 TCTCAGGCCCAGAGATCTCATGG - Intergenic
922756730 1:228101128-228101150 ACAGAGGCTCTGAGGCCTGATGG - Exonic
1063268675 10:4482940-4482962 GCTGAGGCCATTAGGACTCAAGG - Intergenic
1063690756 10:8284894-8284916 TCTCAGGTCCTCAGACCTCAGGG + Intergenic
1064686303 10:17865771-17865793 TCTGATTCCCTGACACCTCAAGG - Intronic
1064971351 10:21070215-21070237 ACTGAGGTCCTGACGACTCAAGG - Intronic
1065455662 10:25904411-25904433 TCTGAGGGCCTGACTTCTCATGG + Intergenic
1066488581 10:35872543-35872565 TCTGAGGGCCAGAGGACGCAGGG + Intergenic
1070493565 10:76999966-76999988 CCTGAGCCCTAGAGGCCTCATGG + Intronic
1071302509 10:84266751-84266773 TCTCAGGCCCTCAAGTCTCAGGG + Intergenic
1071491358 10:86138790-86138812 CATGGGGGCCTGAGGCCTCAGGG - Intronic
1073471985 10:103728112-103728134 TCTGAGGCCCTGAGGCTCTGAGG - Intronic
1074899180 10:117801945-117801967 TCCCAGGGCCTGAGGCATCATGG - Intergenic
1076014586 10:127017730-127017752 GCTCTGTCCCTGAGGCCTCAGGG - Intronic
1076726104 10:132414021-132414043 TCTGCGTCACTGAGGCCTCCAGG - Intronic
1076937242 10:133574732-133574754 TCTGAGGAGCTGGGACCTCATGG + Intergenic
1077014312 11:393129-393151 TCTGAGGCCCTCTAGCCTCTGGG - Intronic
1077152102 11:1077117-1077139 TCAGAGGCCCTGAGGGCACCAGG - Intergenic
1077412992 11:2412101-2412123 CCAGAGGCCGTGTGGCCTCAGGG - Intronic
1078050701 11:7962776-7962798 TCTGTGGCCCTGATCTCTCAAGG - Intronic
1079083615 11:17430349-17430371 GCTGAGGCTGTGAGGGCTCAGGG + Intronic
1079392278 11:20032931-20032953 ACTGAGGCCGTGAGGACTGAGGG - Intronic
1079606952 11:22381812-22381834 TGTGAGGCACTGAGGATTCACGG + Intergenic
1080652886 11:34236614-34236636 CCTTGGGCCCTGAGGCCTCCCGG - Intronic
1081100473 11:38995707-38995729 TCTGAGGATCTGAGGTCTGAAGG - Intergenic
1081735425 11:45400180-45400202 TGTGAGGCCCTCACTCCTCAAGG + Intergenic
1081754789 11:45536854-45536876 TCAGAGGCAGTGAGGCCTCATGG - Intergenic
1083162971 11:60867142-60867164 CCAGTGGTCCTGAGGCCTCAAGG + Intergenic
1083174652 11:60942048-60942070 TCTGTGGCCCTGAGAGCCCAGGG - Exonic
1083615055 11:64022061-64022083 CCTCAGCCCCTGAGGTCTCAAGG - Intronic
1083626344 11:64073943-64073965 GCTGGGGCCCTGAGCCCCCAGGG + Intronic
1084728553 11:71058619-71058641 GCTGAGGCCCTGAGTCCTGTAGG - Intronic
1084748701 11:71189746-71189768 TCTGAGGCCAGCAGGTCTCAGGG + Intronic
1085153682 11:74273197-74273219 TCTGTGTCCTTGAGGTCTCATGG - Intronic
1085260938 11:75204296-75204318 TCAGAGATACTGAGGCCTCAGGG - Intronic
1085416298 11:76321270-76321292 TCTGAGACCCTGAGGGAGCAGGG + Intergenic
1086532645 11:87803869-87803891 TCTCAGGCCTTGGGGCCTAACGG - Intergenic
1086743501 11:90397644-90397666 CCTGAGGCCCAGATGCTTCATGG - Intergenic
1087781615 11:102306737-102306759 TCTGAAGACGTGATGCCTCAGGG - Intergenic
1088843437 11:113645386-113645408 ACTGAGGCCCAGAGACTTCAAGG - Intergenic
1088982336 11:114875034-114875056 TCTGGGGCCCAGAGGCTCCATGG - Intergenic
1089302024 11:117504594-117504616 TTTGAGGCTCTGGGGCCCCAGGG + Intronic
1090340917 11:126019433-126019455 ACTGAGGGAGTGAGGCCTCAGGG + Intronic
1090442966 11:126739402-126739424 ACTGAGGCCCTGAGACATGAAGG + Intronic
1091282869 11:134391842-134391864 TCTGAGGCTCTGAGGGCACCCGG - Exonic
1091592056 12:1848400-1848422 GGTCAGGCCCTGAGGTCTCACGG - Intronic
1095927219 12:47591209-47591231 CCTGAGGCTCAGAGGCATCAGGG - Intergenic
1096601900 12:52735578-52735600 TCAGAGGCCCTGAGACCCCCTGG - Intergenic
1096676588 12:53229662-53229684 GCTGTGGCCCAGGGGCCTCAGGG - Intronic
1096871809 12:54597341-54597363 TCTGAGGCTCTGGGGCTGCAAGG + Intergenic
1097221670 12:57454884-57454906 TCTGGGGCCCTTAGGCCAGAAGG - Intronic
1099701723 12:86092429-86092451 TCTGAGGCCCAGAGGGTTTAAGG + Intronic
1100855421 12:98753322-98753344 TCTGATGCTCTGTGACCTCAGGG - Intronic
1101875438 12:108593962-108593984 TCTCCTGTCCTGAGGCCTCAGGG + Intronic
1103054782 12:117810066-117810088 GCTGAGGCCCCCAGCCCTCAAGG + Intronic
1104666221 12:130649375-130649397 GCGGAGGCCATGAGGCCCCAGGG - Intronic
1104682556 12:130761600-130761622 TCTGCTGCTCTGAGGCCTCGGGG - Intergenic
1104822671 12:131687326-131687348 GCTGAGGCTCTGAGCCCCCAGGG - Intergenic
1105543124 13:21331906-21331928 TCTGGTGACCTGAGGACTCAAGG - Intergenic
1106091786 13:26602214-26602236 TCTGAAGCCCAGAGGCTGCATGG - Intronic
1106960362 13:34990589-34990611 TCAAAGGCCCAGAGGCCTAAGGG - Intronic
1107675594 13:42793586-42793608 ACTGAGGCCCTGAGTCCACCAGG - Intergenic
1108016820 13:46085448-46085470 GCTGAGGCCATGTGGTCTCAGGG + Intronic
1108263004 13:48677105-48677127 TCTGTAGCCCTGAGGCCTCATGG - Intronic
1108753112 13:53468893-53468915 TGTCAGGCCCACAGGCCTCAAGG - Intergenic
1110784865 13:79511834-79511856 TCTGAGCCCCTGGGGTCTTAGGG - Intronic
1111131888 13:83987390-83987412 TCTGTTTCCCTCAGGCCTCAAGG - Intergenic
1113762139 13:112856145-112856167 TCTGAGGCGGTGAGACCTAACGG - Intronic
1114934329 14:27514804-27514826 TCTGAGGCCCTTATGCCACCTGG - Intergenic
1116018306 14:39432353-39432375 TCAGCGGCCCGGAAGCCTCAAGG + Exonic
1116703609 14:48267763-48267785 TCTGAGGACCTGAGGTCGTAGGG + Intergenic
1119181861 14:72610783-72610805 GCTGGGGACCTGAGGGCTCAGGG + Intergenic
1119185854 14:72642053-72642075 CATGAGGACCTGAGGCCTAATGG + Intronic
1121438482 14:93934111-93934133 GCTGAGGACCTCAGGCTTCAGGG + Intergenic
1121696896 14:95920979-95921001 TCTGAAGCCCTGCAGGCTCAAGG + Intergenic
1122022639 14:98851800-98851822 TCTGGGGCCCTGTGGCCTATGGG - Intergenic
1122994110 14:105253397-105253419 TGTGAGGCCCGGGGGCCCCAGGG - Intronic
1123012545 14:105356360-105356382 TCTGAGGCCCTGCGGCGGCACGG - Intronic
1124558464 15:30748783-30748805 CCTGAGACCCTCAGTCCTCAGGG + Intronic
1124641087 15:31397182-31397204 CCTGAGGCCCTGAGGCCAAGAGG + Intronic
1124672789 15:31656847-31656869 CCTGAGACCCTCAGTCCTCAGGG - Intronic
1125501422 15:40242156-40242178 CCTGGGGTCCTGAGGGCTCAGGG + Intronic
1125505339 15:40264812-40264834 TCTGTGGCGCTGAGATCTCAGGG - Exonic
1128570623 15:68730695-68730717 CCATAGGCACTGAGGCCTCATGG + Intergenic
1128672035 15:69580994-69581016 TGTGAGGGCCTGCGGCATCAGGG - Intergenic
1131230300 15:90654475-90654497 TGTGAGGCCAGGAGCCCTCATGG - Intergenic
1131230331 15:90654575-90654597 TGTGAGGCCAGGAGCCCTCATGG - Intergenic
1131267179 15:90923337-90923359 GCTGTGGTACTGAGGCCTCACGG + Intergenic
1133318602 16:4899194-4899216 TCTGGGGGCCTGGGGCATCAGGG - Intronic
1133914202 16:10094077-10094099 TCTGAGGCCCCAAGGTTTCATGG + Intronic
1135663522 16:24316667-24316689 TCAGAGGCCCTGAGGTCTTTGGG - Intronic
1137483763 16:48874710-48874732 TCTGAGGGCCTGAGGGCTGGAGG - Intergenic
1138657958 16:58501483-58501505 TCTGAGGCCCCCAACCCTCAGGG - Intronic
1139357733 16:66377321-66377343 ACTGAGGCCCAGAGGGGTCAGGG + Intronic
1139631502 16:68234503-68234525 CCTGAGGCCCAGAAGGCTCATGG + Intronic
1140588049 16:76318046-76318068 TCTGAGTCCCTGACCCATCAGGG + Intronic
1141134747 16:81457973-81457995 TCTGAAGTCCTGAGTCATCAGGG - Intronic
1141439530 16:84020715-84020737 TCACAGGCTCAGAGGCCTCAAGG - Intronic
1141481226 16:84308208-84308230 TCTCAGGCCCTGAGGCTCCCTGG + Intronic
1141527210 16:84618765-84618787 TCTGCAGCCCTGCAGCCTCAGGG - Intergenic
1141552856 16:84817743-84817765 TCAGAGGCTGTGTGGCCTCAGGG + Intergenic
1141993459 16:87622913-87622935 TCTGAGACCCTGGGACCCCAGGG - Intronic
1142109808 16:88325297-88325319 TCTGAGCCCCTGCGGCCCCCCGG - Intergenic
1142389542 16:89789893-89789915 TCTGAGCTCCTGAGACCTCAGGG - Intronic
1142609739 17:1102266-1102288 TCTGTGGCCACGATGCCTCAGGG - Intronic
1142720858 17:1774920-1774942 TCAGGGGCTCTGAGGCCTCAGGG - Intronic
1142805234 17:2367921-2367943 GCTGGGGCCCTCAGGCCTCCTGG - Intronic
1142871382 17:2823299-2823321 TCTGAGGCCCTTAGGCCCCGGGG - Intronic
1143026949 17:3946678-3946700 TCTGAGACCCTAAGGCCTTCTGG - Intronic
1143302924 17:5924358-5924380 TCTGAGGGCCTGAGCTCTAAGGG + Intronic
1143302977 17:5924623-5924645 TCTGAGGTCCTGAGGTCTTGAGG + Intronic
1143490007 17:7280928-7280950 TCAGAGGCTCAGAGACCTCAGGG + Intergenic
1143864154 17:9911730-9911752 CCTGAGCCCCCGGGGCCTCAAGG - Intronic
1144256116 17:13470379-13470401 TCTGAGGACCTCAGGACCCAGGG + Intergenic
1144293830 17:13854534-13854556 TCTGTGACCCTGTGTCCTCAGGG + Intergenic
1144789452 17:17849349-17849371 TTTGTGGCCCTGAGCCATCAAGG - Intronic
1144794394 17:17881288-17881310 TCTGAAGCCCTGGGTCCTCTTGG + Intronic
1144903947 17:18625028-18625050 TCTGGTGCCCGGAGGCCCCATGG - Intergenic
1147247576 17:39132394-39132416 TCTGAGGCCCTGGGGACACTGGG - Intronic
1147778352 17:42920259-42920281 GGTGAGGCCCTGAGTCCTGATGG + Intergenic
1147987919 17:44316773-44316795 GGCAAGGCCCTGAGGCCTCAAGG + Intronic
1148795798 17:50196122-50196144 TCCCAGGCCCTGAGGCCTACAGG + Intronic
1148810372 17:50286571-50286593 TCTGAGGTCCTCCTGCCTCAGGG - Intergenic
1148933302 17:51144603-51144625 TCTGAGGCCCTGATTCCTGAGGG - Intergenic
1151384013 17:73744205-73744227 TCTGGGGCCCACAGTCCTCAAGG + Intergenic
1152514670 17:80816348-80816370 GCTGAGGGCCTGGGGCCTCCGGG + Intronic
1152537619 17:80959811-80959833 CCTGAGGCCCTGAGGCGCCTGGG - Intronic
1152548017 17:81012687-81012709 TCACAGGCCCTGAGGCCTAGGGG + Intergenic
1153061449 18:999180-999202 TCTGAGGCCCCAAGGGCTGATGG + Intergenic
1153893218 18:9537009-9537031 TCTGATGCTCTGAGGCTTCTGGG + Exonic
1154339582 18:13492192-13492214 TCTGTGCCCCTCAGGCCTGATGG - Intronic
1157536366 18:48461129-48461151 TCTGAGGCCTTGACTCCACAAGG + Intergenic
1157957092 18:52110747-52110769 TATGAGTCCCTGAAGTCTCACGG + Intergenic
1158705286 18:59787064-59787086 TCTAAGGCCCACAGGCCTCAGGG - Intergenic
1159856636 18:73597372-73597394 TATGATGCCCTAAGGCGTCAAGG - Intergenic
1160271719 18:77392761-77392783 TCTGAGGGGCTGAGTACTCAGGG - Intergenic
1160403401 18:78628285-78628307 CCAGAGTCCCAGAGGCCTCAGGG + Intergenic
1160856710 19:1221086-1221108 CCAGAGGCCCTGTGGACTCAAGG - Intronic
1161703579 19:5807405-5807427 GCAGAGGCTCTGGGGCCTCAAGG + Intergenic
1161770825 19:6229933-6229955 TCTGTGGCCCTGGGCCCTGAAGG + Intronic
1161981266 19:7631671-7631693 CCTGAGGGCCTGAGGCATCCTGG - Exonic
1162120512 19:8463922-8463944 TCTGAGGCCTTGTTGTCTCAGGG + Intronic
1162224994 19:9213882-9213904 TCTGAGGCCCTGATTTGTCATGG + Exonic
1163595848 19:18220678-18220700 GCTGAGGCCCAGAGATCTCATGG - Intronic
1163983436 19:20923329-20923351 TCTGTGGCCCTGTGGCCTGCAGG + Exonic
1164625609 19:29725713-29725735 GCTGAGGCACTCAGGCCTCATGG - Intergenic
1164656892 19:29928380-29928402 ACTGAGGCTCAGGGGCCTCAGGG - Intronic
1164685020 19:30160840-30160862 TCTGAGGCCCCGACACCTCCAGG - Intergenic
1165160552 19:33813229-33813251 TCTGAGGCCCCGGGGCCTGTTGG + Exonic
1165442684 19:35839395-35839417 TATGAGGCCCTGGGGACTCCAGG - Exonic
1165549641 19:36573326-36573348 TCCGCGGCCCTGAGGCCTGTGGG + Intronic
1165668532 19:37655242-37655264 TCTGCAGCCCTGAGGCCTGGAGG - Exonic
1166392026 19:42413712-42413734 TGAGGGGCTCTGAGGCCTCAGGG + Intronic
1166854926 19:45778677-45778699 CCTGAGGCCCTGATCCATCACGG + Intronic
1166992905 19:46704058-46704080 TCTGAGGCCCTGGGGTCCCAAGG + Intronic
1166997371 19:46726113-46726135 GCAGAGGCCCTGAGGCAGCAAGG + Intronic
1167156188 19:47740814-47740836 CCTGAGGCCCTCAGGCTGCAAGG - Intronic
1167286426 19:48601146-48601168 TCTGACGGCCTGACGCCTCTGGG + Exonic
1168491926 19:56818189-56818211 TGTAAGGCCATGGGGCCTCAAGG - Intronic
925153312 2:1632272-1632294 ACTGAGACCATGAGGCCTCCAGG + Exonic
925206737 2:2013528-2013550 TCTGAGCCCTTGTGCCCTCACGG - Intronic
925230869 2:2232844-2232866 CCTCAGGCCCTGCGTCCTCATGG + Intronic
925273702 2:2634167-2634189 TCTGAGGCCTGGATGCCTCTCGG + Intergenic
925273710 2:2634232-2634254 TCTGATGCCCGGATGCCTCTCGG + Intergenic
925337367 2:3108167-3108189 GCTGCTGCCCTGAGGCCTCCCGG - Intergenic
926690550 2:15730509-15730531 CCTGAGACCCTGAGGTTTCAGGG + Intronic
928031155 2:27780554-27780576 TCTTAGGGCTTGTGGCCTCATGG + Intronic
930022602 2:47010545-47010567 TCTGAGTCCCTGAAGCCTGGGGG + Intronic
930642277 2:53865740-53865762 TGTGTGGCCCTGAGGACTCTGGG - Intronic
931964666 2:67519927-67519949 CTTGAGGCACTGATGCCTCAAGG - Intergenic
933138717 2:78767153-78767175 TCTGAGGCTCAGAGACTTCATGG + Intergenic
934164019 2:89278038-89278060 TCTGTGGTCCTCAGCCCTCATGG - Intergenic
934203255 2:89904486-89904508 TCTGTGGTCCTCAGCCCTCATGG + Intergenic
937693453 2:124781589-124781611 TCTTAGGCCCTGAGGCGTTTGGG - Intronic
937974860 2:127576528-127576550 TCTGAGGCCCTGAGGCCTCAGGG + Intronic
948284047 2:236770211-236770233 TCTGAGTCACTGCAGCCTCACGG - Intergenic
948716663 2:239869708-239869730 TCCTAGGTCCTGAGGCCCCATGG - Intergenic
948895799 2:240926315-240926337 TCTGAGACCCTGAGGCATGCAGG + Intronic
948908055 2:240989224-240989246 TGTCAGGCCCCTAGGCCTCAGGG - Intronic
948981811 2:241498391-241498413 CCTGAGGCCCTCATGCCTCCTGG - Intronic
948994971 2:241573400-241573422 TCTCAGGACATGAGTCCTCAGGG + Exonic
949037108 2:241820991-241821013 TCCGAGGCCCTGACTCCTCCAGG + Intergenic
1169252046 20:4068421-4068443 CCTGAGGTGGTGAGGCCTCAAGG + Intergenic
1169343926 20:4815405-4815427 CCAGAGTACCTGAGGCCTCATGG + Intronic
1171310948 20:24144190-24144212 TCTCAGGCCTTGAGGGCTAATGG + Intergenic
1172091443 20:32435677-32435699 TCTGAAGCACTGAGTCCTCACGG + Exonic
1173174514 20:40754408-40754430 ACTGAGGCCCTGAGGGATTAAGG + Intergenic
1173541362 20:43854123-43854145 TGTGAGGCCCATGGGCCTCATGG - Intergenic
1173738725 20:45380587-45380609 TCTGAGGCCCTGGTGCCTGGTGG + Intronic
1173891505 20:46514934-46514956 TGAGAGGCCCTGAGACCACATGG + Intergenic
1173918454 20:46726444-46726466 TGAGGGGCCCTGAGGCTTCATGG - Intronic
1174004904 20:47402782-47402804 TCTGAGGCTCTGAGGGTACAAGG + Intergenic
1174452565 20:50629102-50629124 GCTGAGGCCCTGAGGCCGGGAGG + Intronic
1174858642 20:54069743-54069765 ACTGAGGCCCAGAGGGCTGAGGG + Intronic
1175375240 20:58519578-58519600 TCTGAGGCCCTGAAACCACATGG + Intergenic
1176109531 20:63405101-63405123 CCTGAGGCCCTGAGGCCAGCAGG - Intergenic
1176121067 20:63454817-63454839 CCTGGGACCCTGAGGCCACATGG - Intronic
1176127878 20:63484071-63484093 GCTGGGGCCCTGAGGCTGCACGG + Intergenic
1176270129 20:64232007-64232029 GCTGAGGTCCTGGAGCCTCAGGG - Intronic
1178443524 21:32618080-32618102 TCTGTGGCCTGGGGGCCTCAAGG - Intergenic
1178896897 21:36566537-36566559 GTTGAGGCCCTGGGGCCTCACGG + Intronic
1179890811 21:44334285-44334307 TCGGAGGCCCTGTGGCCCCTGGG + Intronic
1179894667 21:44354808-44354830 ACTGAGGCCCTGAGGGGTCTTGG - Intronic
1179949298 21:44700648-44700670 GCTGAGGGGCTGAGGCTTCAGGG - Intronic
1179981423 21:44897830-44897852 TGTGTGGCCCTGAGGCCACAGGG - Intronic
1180026858 21:45169526-45169548 TCTCAGGTCCTGAGGCCCCCTGG + Intronic
1180157370 21:45984047-45984069 TCTGAGGGCCTGAGGGATCGGGG + Intronic
1180799255 22:18624190-18624212 GAGGAGGCCCTGAGGCTTCAAGG + Intergenic
1180899785 22:19361882-19361904 GCTGAGGCCCCGAGACCTCCTGG - Exonic
1181222463 22:21371076-21371098 GAGGAGGCCCTGAGGCTTCAAGG - Intergenic
1181264914 22:21625306-21625328 TCTGATCCTCTGAGGCCTCCAGG - Intergenic
1181336509 22:22135938-22135960 TCTAAGGCAGTGAGGCCTTATGG + Intergenic
1181484272 22:23220556-23220578 TCTGAGGCCCTGAGGCTGCCTGG + Intronic
1181495503 22:23285283-23285305 CCTGGGGCCCAGAGGCCTGACGG - Intronic
1181638219 22:24184062-24184084 GAGGAGGCCCTGAGGCTTCAAGG - Intronic
1181865058 22:25848279-25848301 CGGGAGGCCCTGAGGCCTAAAGG + Intronic
1182444026 22:30379945-30379967 TCTGTGGCCCTGGGGGCTGAAGG + Intronic
1182828048 22:33282728-33282750 TTTGAGCCCCTGAGGCCTGGGGG - Intronic
1183996117 22:41633782-41633804 TCTGAGGTCTTTAGGCATCAAGG - Intronic
1184689467 22:46110841-46110863 TCTGAGGCCTTGAGGGAACACGG + Intronic
1185004061 22:48265088-48265110 TCTGAGGGCCTGTGGCCTCCGGG + Intergenic
1185337024 22:50275307-50275329 TCTGAGGGCCTGTGGCCCCCAGG - Exonic
1185361107 22:50407466-50407488 TGTGAGGTCCTGGGGCATCATGG + Intronic
951844180 3:27067886-27067908 CCTGAGCCCCTGTGGCCTCTAGG + Intergenic
952093607 3:29921701-29921723 ACTGAGACCCTGAAGTCTCAAGG - Intronic
953552760 3:43917203-43917225 TCTTAGGCCCTAAGGCCTGGAGG - Intergenic
953691866 3:45126459-45126481 CCTGAGGCAGTGAGGCCTAAAGG + Intronic
953972685 3:47359463-47359485 TCACAGGCCCTGAGGCCTAGTGG + Intergenic
953979502 3:47406612-47406634 TGTGAGGGCCTGGGGCCCCAGGG + Exonic
954630352 3:52044624-52044646 TCTGAGGGCCAGATACCTCAGGG + Intergenic
954863920 3:53712965-53712987 TGTGACGCCCTGAGGCCTCTGGG + Intronic
955952410 3:64255587-64255609 TCTGCTGCCATAAGGCCTCAGGG + Intronic
957117160 3:76041371-76041393 TCGGAGACCCTCAGACCTCAAGG + Intronic
959593572 3:108104767-108104789 TTTGAGGCACTGAGGACTTAAGG - Intergenic
961311290 3:126003761-126003783 TCTGGGGCCCTGAGAGCACAGGG - Intergenic
962309512 3:134315146-134315168 TCTGAGCACATGAGGCCACACGG + Intergenic
962383100 3:134912653-134912675 TCCCAGGCCATCAGGCCTCAGGG - Intronic
962907321 3:139816397-139816419 TCTGAAGCCCTCCTGCCTCAGGG - Intergenic
963297018 3:143557507-143557529 TCTGAGTCCCTGAAGTCTCTAGG - Intronic
963382912 3:144554296-144554318 TATGAGGCTCTCAGTCCTCAAGG - Intergenic
963483220 3:145903733-145903755 TCCCAGGCCCTGAGGCCACAGGG - Intergenic
963811216 3:149778218-149778240 TCTGATGCTCTGTGTCCTCATGG + Intronic
965026234 3:163304516-163304538 TCCTAGGCCCTGAGTCCTGATGG + Intergenic
966877173 3:184329046-184329068 GCTGTGGCCCTGAAGCTTCATGG + Intronic
968504266 4:964691-964713 GCAGAGGCCCTAAGGCCTCCCGG + Intronic
968649368 4:1754337-1754359 CTTGAGGCCCTGAGACCTGAAGG + Intergenic
968649653 4:1755461-1755483 TCCGGGGCCCTGTGGCCTCGTGG - Intergenic
968675053 4:1872300-1872322 TCTCATGCACTGAGGCTTCAAGG - Intronic
968754429 4:2408114-2408136 TCTGTGGCCTTGAGGCCTGGAGG - Intronic
968975095 4:3817995-3818017 TCTGAGGCTGTGATGCCACAGGG + Intergenic
969100768 4:4766525-4766547 CCAGAGACCCTGAGGCCACATGG - Intergenic
969290098 4:6233360-6233382 TCTGTGCCCATGTGGCCTCAGGG + Intergenic
969447692 4:7254915-7254937 TCGGATGCCCTGGGACCTCATGG - Intronic
969954614 4:10875783-10875805 TTTGAGGCCCTGAGTCCTGTGGG + Intergenic
970057622 4:11993643-11993665 TCACAGGCCCAGAGGCCTCGGGG + Intergenic
971449911 4:26790254-26790276 TCTGAGGCCCTGCGGGATGATGG + Intergenic
972643221 4:40944045-40944067 TCTAATGCCCTCATGCCTCAAGG + Intronic
973555798 4:52081425-52081447 CCTGAAGCCCTGAGGCCAGAAGG - Intronic
975204096 4:71624294-71624316 TCTCAGGCCCAGAGGCCTTGGGG - Intergenic
981853042 4:149254437-149254459 TCTTCGCCCCTGAGGCATCAGGG + Intergenic
982566914 4:156997140-156997162 TCACAGGCCCTGAGGCCTAGGGG - Intergenic
983148709 4:164249366-164249388 TCTGAGGCCCTGAGGCAGAGAGG + Intronic
983631556 4:169854427-169854449 ACTGAGTCCCTCAGGTCTCAGGG - Intergenic
984762901 4:183377727-183377749 ACTGATGCCCTGAGTTCTCATGG + Intergenic
985425750 4:189828623-189828645 GCTGGGGCCCTGAGGGCACAGGG - Intergenic
985646964 5:1089467-1089489 TCTCAGGCCCTGAGCCATCCAGG - Intronic
985647439 5:1091572-1091594 CCTGAGCCCATGAGGCCTCAAGG + Intronic
985647701 5:1092899-1092921 CCTCAGGGCCTCAGGCCTCAGGG + Intronic
985970788 5:3376903-3376925 GCTGTGGCCTGGAGGCCTCAGGG + Intergenic
986190786 5:5494698-5494720 CCTGAGGCCCTGAGGCCCAGCGG + Intergenic
986450000 5:7853952-7853974 TGTGAGGCCCTGAGGATGCAGGG + Intronic
987097318 5:14561381-14561403 TGTGAGGTCATGAGGCTTCAGGG - Intergenic
987777995 5:22394597-22394619 TCTGAGACCCTGAAACCTAATGG + Intronic
990363715 5:55047795-55047817 GCTGAGCTCCTTAGGCCTCAAGG + Intergenic
997212904 5:132087930-132087952 TTTTAGGCCCTCAGGCCTCTGGG - Intergenic
998095981 5:139395697-139395719 CCTGAGGCCCTGAGGAGTCAGGG - Exonic
999247690 5:150163916-150163938 ACAGAGGCCCTGAGGCCCGAGGG - Intergenic
999347261 5:150835086-150835108 TCTTGGGGCTTGAGGCCTCATGG + Intergenic
1000088968 5:157913204-157913226 TCTGAGGCCCTGGTGACCCATGG + Intergenic
1001759061 5:174192621-174192643 GTTGAAGCCCTGAGACCTCAAGG + Intronic
1003244772 6:4374520-4374542 TGTGAGCACCTGAGGCCACAGGG - Intergenic
1003408865 6:5845893-5845915 TCTGGTGACCTGAGGACTCAAGG + Intergenic
1004168272 6:13275675-13275697 ACTGAGGATCTGAAGCCTCAGGG - Intronic
1006452001 6:34110744-34110766 TCTGATGCCCTGGGGACTCACGG - Intronic
1007251819 6:40500357-40500379 TCTGAGGCTCTGAAGCCAGAGGG - Intronic
1007470736 6:42088628-42088650 GCTGAGGCAAGGAGGCCTCAGGG - Intergenic
1011771503 6:90678526-90678548 TCAGAGGCCCTCAGGGCTCCGGG - Intergenic
1013479593 6:110542599-110542621 TCTGTGCCCCTGAGGGCTCCAGG - Intergenic
1013618940 6:111871274-111871296 TCTGAGGCTTTGAGGCCACTTGG - Intronic
1014724968 6:124962626-124962648 CCTGAGCCCCCGAGGCCTCAGGG + Exonic
1015271058 6:131339337-131339359 TCTGAGGACCTGAGGTCATAGGG - Intergenic
1016072414 6:139755564-139755586 CCTGAGGTCCTTAGGCTTCAAGG + Intergenic
1016118345 6:140316308-140316330 TTTGTGGCCCTGAGGCCTTCAGG + Intergenic
1018080569 6:160256242-160256264 TCAGAGGCCCTGAAGGCTGATGG + Intronic
1018475319 6:164134804-164134826 TCCGTGGACCTGAGGTCTCAAGG - Intergenic
1018756141 6:166851237-166851259 TCTGAGCCCCTGAGGACTGGTGG - Intronic
1019346532 7:533500-533522 TCTGAGCCCCGGTGGCCTAAAGG + Intergenic
1019505586 7:1388913-1388935 GCAGAGGCACTGGGGCCTCAGGG + Intergenic
1019606845 7:1914173-1914195 TCCCAGGTCCTGAGGCCTCCAGG - Intronic
1019715414 7:2536570-2536592 TCTGTGGCCTTGAGGGGTCAGGG + Intergenic
1019741405 7:2676570-2676592 TCTGTGGCCTTGAGGGGTCAAGG - Intergenic
1022273091 7:28829492-28829514 TCTTTGGCTCTGAGGCCACATGG + Intergenic
1023145925 7:37151177-37151199 TCTCAGGTCCTGAGGTCTCTTGG + Intronic
1024633059 7:51264984-51265006 ACTGAGGGCCAGAGGCCTCTGGG - Intronic
1027254489 7:76422352-76422374 ACTGAGGGCCTGAGGACCCATGG - Intronic
1028154498 7:87414305-87414327 TCTGAAGCCCCAGGGCCTCACGG - Intronic
1029268361 7:99360010-99360032 TCTGAGGTGGTGGGGCCTCAGGG + Intronic
1033372945 7:140728135-140728157 ACTGAGTGCCTGATGCCTCACGG + Intronic
1033433176 7:141307567-141307589 TCAGAGGCACTGAGGGGTCACGG + Intronic
1033658402 7:143388227-143388249 TCAGGGGCCCTGGGGCCCCAGGG - Exonic
1033984939 7:147213812-147213834 TCTGAAGGCCTGAGAACTCAGGG + Intronic
1035029489 7:155848254-155848276 CAGGAGGCCCTGAGGCCTCAGGG + Intergenic
1035487499 7:159237342-159237364 TATGCGGCCCTCAGGCCTGATGG - Intergenic
1039441489 8:37598342-37598364 CCTGAGGCCCTGGGGCCTTGTGG + Intergenic
1041431210 8:57782654-57782676 TCTAAAGCTCTGAGGACTCATGG + Intergenic
1043418815 8:80078523-80078545 TCTTATGCCCTGAGGGGTCATGG + Intronic
1043460135 8:80451549-80451571 TCCTAGGCCCTGAGGACACAAGG - Intergenic
1045235587 8:100350332-100350354 TCTGAAGGCCTGAGGCCTGCGGG - Intronic
1046793891 8:118349770-118349792 CCTGAGTCTCTGAGGACTCAGGG - Intronic
1047509364 8:125504633-125504655 TCTGTGGCCATGAGGCGACATGG - Intergenic
1048522490 8:135169664-135169686 TGCCAGGCCCTGAGGCCTGATGG - Intergenic
1048938455 8:139376302-139376324 GCTGAGGCCCTGAGGGCAAAAGG + Intergenic
1049029782 8:140025745-140025767 TCTGACACCCTGAGGCAACATGG + Intronic
1049361437 8:142214094-142214116 TCTGAGGGCCTCAGGGCTCAGGG + Intronic
1049624961 8:143615773-143615795 CCAGAGGCCCTGGGGACTCAGGG + Intronic
1049871332 8:144980052-144980074 TCTGAGGAGTTGAGTCCTCAAGG + Intergenic
1052825114 9:33168336-33168358 ACTCAGGGCCTGAGGCCTCTGGG - Intergenic
1052973959 9:34398600-34398622 TCTGTGGCCCTGAGACACCAGGG - Exonic
1055456047 9:76472488-76472510 GCTGAGGCCCTGGGGCATAAGGG - Intronic
1056629129 9:88278163-88278185 TCTCCTGCACTGAGGCCTCAAGG - Intergenic
1057067445 9:92068804-92068826 TCCGAGGGCATGAAGCCTCATGG - Intronic
1060560716 9:124540407-124540429 TCTCAAGCCGTGAAGCCTCAAGG + Intronic
1060979225 9:127783200-127783222 ACTGAGGCCCTGAGGCCCCAAGG + Intergenic
1061389393 9:130309179-130309201 TCTCCGCCCCTGAGGCCTGATGG - Intronic
1061865965 9:133491935-133491957 GATGAGGCCCTGAGGCCTGGAGG + Intergenic
1062480115 9:136747218-136747240 TCTGTGTCCCTGGGGCCTCCAGG - Intronic
1062507958 9:136887442-136887464 TTTGAGGCCCCGAGGGCTGAGGG + Intronic
1062587687 9:137256738-137256760 TCTGCGGGGCTGAGGCCTCTTGG + Intronic
1186221543 X:7354508-7354530 TCTGAGGCCCTGAGCATTCTTGG + Exonic
1187261297 X:17687311-17687333 TCTGAGGCCCTGCGGCCAGAAGG + Intronic
1190301844 X:49061654-49061676 GCAAAGGCCCTGAGGCCTGAGGG + Intronic
1191260643 X:58316195-58316217 TCTGAGGCCTATAGGCCTCAAGG - Intergenic
1192226854 X:69234846-69234868 TCAGAGGCCCAGAGGCCCCCAGG + Intergenic
1194313274 X:92340712-92340734 TCACAGGCCCTGAGGCCTAGGGG - Intronic
1196936340 X:120734693-120734715 ACAGAGGCCCTGATGTCTCAGGG + Intergenic
1199582672 X:149376066-149376088 TCTGATGCCCAGGGGCCTCTTGG + Intergenic
1199964983 X:152812188-152812210 TCTGCTGCCCTGTGGGCTCAGGG + Intergenic
1200621539 Y:5454826-5454848 TCACAGGCCCTGAGGCCTATGGG - Intronic