ID: 937974885

View in Genome Browser
Species Human (GRCh38)
Location 2:127576633-127576655
Sequence GCTCATGGGGGTGAGTGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 316}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937974873_937974885 24 Left 937974873 2:127576586-127576608 CCCTCCCAGGCTCCCGAGGAGCG 0: 1
1: 0
2: 0
3: 51
4: 1596
Right 937974885 2:127576633-127576655 GCTCATGGGGGTGAGTGCTGAGG 0: 1
1: 0
2: 3
3: 26
4: 316
937974880_937974885 -5 Left 937974880 2:127576615-127576637 CCATATCTTCTACTGCATGCTCA 0: 1
1: 0
2: 0
3: 13
4: 195
Right 937974885 2:127576633-127576655 GCTCATGGGGGTGAGTGCTGAGG 0: 1
1: 0
2: 3
3: 26
4: 316
937974874_937974885 23 Left 937974874 2:127576587-127576609 CCTCCCAGGCTCCCGAGGAGCGG 0: 1
1: 0
2: 3
3: 42
4: 601
Right 937974885 2:127576633-127576655 GCTCATGGGGGTGAGTGCTGAGG 0: 1
1: 0
2: 3
3: 26
4: 316
937974878_937974885 12 Left 937974878 2:127576598-127576620 CCCGAGGAGCGGAACTACCATAT 0: 1
1: 0
2: 0
3: 4
4: 45
Right 937974885 2:127576633-127576655 GCTCATGGGGGTGAGTGCTGAGG 0: 1
1: 0
2: 3
3: 26
4: 316
937974877_937974885 19 Left 937974877 2:127576591-127576613 CCAGGCTCCCGAGGAGCGGAACT 0: 1
1: 0
2: 0
3: 8
4: 194
Right 937974885 2:127576633-127576655 GCTCATGGGGGTGAGTGCTGAGG 0: 1
1: 0
2: 3
3: 26
4: 316
937974870_937974885 28 Left 937974870 2:127576582-127576604 CCCTCCCTCCCAGGCTCCCGAGG 0: 1
1: 0
2: 6
3: 59
4: 693
Right 937974885 2:127576633-127576655 GCTCATGGGGGTGAGTGCTGAGG 0: 1
1: 0
2: 3
3: 26
4: 316
937974879_937974885 11 Left 937974879 2:127576599-127576621 CCGAGGAGCGGAACTACCATATC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 937974885 2:127576633-127576655 GCTCATGGGGGTGAGTGCTGAGG 0: 1
1: 0
2: 3
3: 26
4: 316
937974876_937974885 20 Left 937974876 2:127576590-127576612 CCCAGGCTCCCGAGGAGCGGAAC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 937974885 2:127576633-127576655 GCTCATGGGGGTGAGTGCTGAGG 0: 1
1: 0
2: 3
3: 26
4: 316
937974872_937974885 27 Left 937974872 2:127576583-127576605 CCTCCCTCCCAGGCTCCCGAGGA 0: 1
1: 0
2: 3
3: 43
4: 569
Right 937974885 2:127576633-127576655 GCTCATGGGGGTGAGTGCTGAGG 0: 1
1: 0
2: 3
3: 26
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937974885 Original CRISPR GCTCATGGGGGTGAGTGCTG AGG Exonic
900110624 1:1004009-1004031 GCTAAGGGGGGTGACTGATGAGG + Intergenic
900297653 1:1960050-1960072 GCACACGGGGGTTAGTGCTGCGG + Intronic
900335349 1:2160456-2160478 GCTCATGGGGGACAGGCCTGTGG + Intronic
900765482 1:4502164-4502186 GGTCCAGGGGGTGGGTGCTGGGG - Intergenic
900922647 1:5683316-5683338 GGCCCTGGGGGTGAGTGGTGGGG - Intergenic
901068381 1:6505471-6505493 GCTCCTGGGGGTGAGAGGTTGGG - Intronic
901126200 1:6930549-6930571 GCTCATGGGGGTTAGGGGTTCGG + Intronic
901137789 1:7009084-7009106 GCTCCTGAGAGTGAGGGCTGAGG - Intronic
903507616 1:23849424-23849446 TCTCATGGTGCTGAGTGCAGTGG + Intronic
903693992 1:25194316-25194338 GAGCATGGGTGTGTGTGCTGTGG - Intergenic
904863540 1:33558774-33558796 GATAAAGGGGGTGAGGGCTGGGG - Intronic
905249756 1:36640322-36640344 GCTCAGGAGGGTGAGATCTGAGG + Intergenic
905452976 1:38068734-38068756 GCACATGGGGCTCAGAGCTGAGG + Intergenic
906260062 1:44380301-44380323 GCTAACAGGGGTGTGTGCTGTGG + Intergenic
907956324 1:59231447-59231469 TCGCATGGAGGTAAGTGCTGGGG - Intergenic
908781507 1:67695229-67695251 GCTCATTGGGGTGAGGGGTGTGG + Intergenic
911850431 1:102811633-102811655 GCTCCTGGGGGCTAGTGCGGTGG - Intergenic
915474798 1:156147227-156147249 GCTTAAGGGGGTGAGTGTAGAGG - Intergenic
915554144 1:156652142-156652164 GCTCAGGAGGGTGAGCCCTGGGG - Intronic
916660139 1:166915929-166915951 GCTCCTGGGGCTCAGTTCTGCGG - Exonic
917962504 1:180155599-180155621 GCTGCTGTGGGTCAGTGCTGGGG + Intronic
918069313 1:181123217-181123239 GCTCTTGGGTGTGACTGATGAGG - Intergenic
919135006 1:193496793-193496815 GGGCCTGGTGGTGAGTGCTGAGG + Intergenic
920534555 1:206729176-206729198 GCTCTTGGGGAAGGGTGCTGAGG + Intronic
921342045 1:214143888-214143910 GCCCATGGGGGCAAGTGATGGGG + Intergenic
922815397 1:228445730-228445752 GCTCGCCGGGCTGAGTGCTGAGG + Intergenic
923013127 1:230104762-230104784 GCTCATGTGCCTGAGTGCAGCGG + Intronic
923274945 1:232387476-232387498 GCTCATGTGTGTGTCTGCTGGGG - Intergenic
1063209047 10:3862108-3862130 GCTCCTGGGGGTTCCTGCTGCGG + Intergenic
1063901914 10:10742339-10742361 ACTCTTTTGGGTGAGTGCTGTGG + Intergenic
1064877490 10:20011276-20011298 GCTCATGGAGAGGTGTGCTGGGG + Intronic
1066326158 10:34361118-34361140 GGTCATGGGCGGGATTGCTGAGG - Intronic
1067086066 10:43238795-43238817 GCTCATGGGGATGGCAGCTGTGG - Intronic
1067142453 10:43668566-43668588 GCTCCTTGGGCTGAGTGCAGTGG - Intergenic
1067564661 10:47327758-47327780 GCACACTGGGGTGAGTGATGTGG + Intergenic
1067564724 10:47328386-47328408 GCACACTGGGGTGAGTGATGTGG + Intergenic
1067564788 10:47328875-47328897 GCACACTGGGGTGAGTGATGTGG + Intergenic
1067564798 10:47328935-47328957 GCACACTGGGGTGAGTGATGTGG + Intergenic
1067564808 10:47328995-47329017 ACTGAGGGGGGTGAGTGATGTGG + Intergenic
1067564829 10:47329110-47329132 GCACATTGGGGTGAGTGATGTGG + Intergenic
1067564840 10:47329195-47329217 GCACACTGGGGTGAGTGATGTGG + Intergenic
1067564873 10:47329399-47329421 GCACACTGGGGTGAGTGATGCGG + Intergenic
1067564883 10:47329455-47329477 GCACACTGGGGTGAGTGATGCGG + Intergenic
1067564903 10:47329593-47329615 GCACACTGGGGTGAGTGATGTGG + Intergenic
1067841934 10:49688163-49688185 GCTGGTGGGGGTGAGTGCTAGGG - Intronic
1067944491 10:50681662-50681684 GATCTTGGGGGTGTGTCCTGGGG + Intergenic
1068013440 10:51483306-51483328 GCTCAGGGGGCTGGGTGCGGTGG - Intronic
1070950572 10:80427861-80427883 GCTCATGGGTGGCACTGCTGGGG + Intronic
1071632891 10:87230754-87230776 GATCTTGGGGGTGTGTCCTGGGG + Intronic
1071646340 10:87362972-87362994 GATCTTGGGGGTGTGTCCTGGGG + Intronic
1072930332 10:99656886-99656908 GCTCATAGGGCTGAGTTCCGAGG - Intergenic
1073102619 10:101014573-101014595 GCAGATAGGGGTGTGTGCTGGGG - Intronic
1073267264 10:102235210-102235232 GCTCCTGGGACTGAGAGCTGAGG - Intronic
1075484954 10:122814349-122814371 GCTCATGGAGGCCAGGGCTGGGG + Intergenic
1076053183 10:127351482-127351504 TGTCCTGGGGGTGCGTGCTGTGG + Intronic
1076698210 10:132257146-132257168 CCTCAGGGGGGTGAGGCCTGTGG + Intronic
1076776228 10:132699618-132699640 GCTCTTGGGGGTGGGGGCCGAGG + Intronic
1076908565 10:133376056-133376078 GGTAATGGGGGGGACTGCTGAGG + Intergenic
1077316476 11:1921476-1921498 GCTCGTGGGGCTGAGGACTGAGG + Intronic
1078152760 11:8773289-8773311 GCTCATGGTGGTCGCTGCTGTGG - Intronic
1078258629 11:9683284-9683306 GCTGCTGGGGGTGAGGGGTGGGG + Intronic
1078611630 11:12824675-12824697 GGTGATGGGGGTGAGGGTTGGGG + Intronic
1079334798 11:19561919-19561941 GCTCCTGGAGATGAGGGCTGAGG + Intronic
1081616457 11:44594341-44594363 GGTCATGGAGGTGAGGGGTGAGG + Intronic
1083299755 11:61734253-61734275 GGCCGTGGGGGTGAGGGCTGAGG + Intronic
1083311210 11:61784685-61784707 GCCCATGGCGGGGAGGGCTGTGG + Intronic
1089279055 11:117359825-117359847 GCTCAAGGAGATGAGTGCTAGGG - Intronic
1090425660 11:126605408-126605430 GCTCAGGGGGAGGAGTCCTGCGG + Intronic
1092299432 12:7231446-7231468 TCCCAAGGGGCTGAGTGCTGTGG - Intergenic
1094074768 12:26460336-26460358 GCCCATGGAGGAGAGTGTTGTGG + Intronic
1095944535 12:47746506-47746528 GCTCCTGGTGGCCAGTGCTGTGG - Intronic
1096776681 12:53968604-53968626 GCTCCGTGGGGTGAGTGTTGTGG - Intergenic
1096978275 12:55713028-55713050 GCTAATGGGGGTTAGTGTTGGGG - Intronic
1097190200 12:57216149-57216171 CCTCGTGGGGGTCAGTGGTGGGG + Intergenic
1098140267 12:67443818-67443840 GCTTATGTGGGGCAGTGCTGAGG - Intergenic
1099643581 12:85321806-85321828 GCTTATGGGGGTGGGGGCTGGGG - Intergenic
1100632603 12:96403184-96403206 GGCCATGGGGCTGGGTGCTGTGG - Intergenic
1101489850 12:105200503-105200525 TTTCATGGAGGTGTGTGCTGAGG + Intronic
1102144443 12:110644386-110644408 GCTCGTGGGGCTGAGAGCAGTGG + Intronic
1103923602 12:124411911-124411933 TCTCATGGGGGTGGGTGTGGAGG + Intronic
1104182714 12:126398181-126398203 ACACATGGGGCTAAGTGCTGGGG + Intergenic
1105805824 13:23951118-23951140 GCTCATGGGGTGGAATTCTGGGG - Intergenic
1106065144 13:26340642-26340664 GTTAATGGAGGTGAATGCTGGGG - Intronic
1107965360 13:45593011-45593033 CAACATGGGTGTGAGTGCTGTGG - Intronic
1108492105 13:50992030-50992052 GCCCGTGCGAGTGAGTGCTGGGG + Intergenic
1112289155 13:98129771-98129793 GCTCCTGAGGATGAGGGCTGGGG + Intergenic
1113645659 13:111993541-111993563 GGTCATGGTGCTGAGTGCTATGG - Intergenic
1113834879 13:113322195-113322217 GCTGATGTGGGGGAGTGGTGGGG + Intronic
1114495450 14:23128547-23128569 GCACATGGGTGTGTCTGCTGAGG + Intronic
1114504928 14:23203128-23203150 GATCTTGGGGGTGAGGGTTGGGG - Intronic
1114600621 14:23953328-23953350 GCCCATGGAGGTGAGGCCTGTGG - Intergenic
1114604858 14:23988472-23988494 GCCCATGGAGGTGAGGCCTGTGG - Intronic
1114610304 14:24036019-24036041 GCCCATGGAGGTGAGGCCTGTGG - Intergenic
1118839273 14:69499026-69499048 GCTCTTGGGGGAGGGAGCTGAGG + Intronic
1119480891 14:74956915-74956937 GGTCACTGGGGTGAGAGCTGGGG - Intergenic
1119625601 14:76172010-76172032 GCTCAAAGAGGTGAGTTCTGAGG + Exonic
1119833333 14:77723635-77723657 ACTAATGGGGCTGAGTGCAGTGG - Intronic
1121117051 14:91351359-91351381 GCCCATGTGAGTGAGTGTTGGGG - Intronic
1122129641 14:99597630-99597652 TCTTAGGGGGGTTAGTGCTGTGG - Intronic
1122362906 14:101177948-101177970 GCACATGGGGGAGAGAGCTATGG - Intergenic
1122838529 14:104443232-104443254 TCTCGTGGGGGACAGTGCTGGGG - Intergenic
1123799760 15:23807763-23807785 GCTGATGTCGGTGAGTGGTGAGG + Intergenic
1124595741 15:31090100-31090122 GTTCATGGGGGTTACTGCTAGGG - Intronic
1125269435 15:37921816-37921838 GCTCTTGGGGGTGGGGGCGGAGG - Intergenic
1126250873 15:46566290-46566312 GCTCATGGTGGTGAGGCTTGAGG + Intergenic
1127800328 15:62472100-62472122 ACTCATGGGGGTGGGTGCATGGG - Intronic
1128601759 15:69000949-69000971 GCTAGTGGGGCTGAGTGTTGTGG + Intronic
1128708920 15:69857543-69857565 GCTCCCGGAGGTGAGGGCTGGGG - Intergenic
1129101947 15:73273228-73273250 GCCCATGTAGGTGTGTGCTGAGG + Intronic
1129515845 15:76156895-76156917 GCTCATGGGGATGGCCGCTGGGG + Intronic
1130662300 15:85840285-85840307 GCTCATGGGGGAAAGGGCGGGGG + Intergenic
1130836595 15:87655739-87655761 AGTCATGGGGGTGAGTGTGGTGG + Intergenic
1131069959 15:89459986-89460008 GCTCATTGGGGTGTGTGCTGTGG - Intergenic
1132099775 15:99015099-99015121 GCTCCCGAGGGTGAGTGCGGGGG - Intergenic
1132579829 16:679851-679873 GCTGATGGGGCCGGGTGCTGGGG + Intronic
1134012592 16:10866409-10866431 GCTCATGGAGCAGAGTGCAGTGG - Intergenic
1136043284 16:27597051-27597073 GGTCATGATGGTGCGTGCTGTGG + Intronic
1136140381 16:28284408-28284430 GCCCATGGGGGTGTGTGCTGGGG - Intergenic
1138356383 16:56384264-56384286 GCTGATGGTGATGAGTGCTCTGG - Intronic
1140342842 16:74182324-74182346 GCTGATGGGGGTCACTTCTGAGG + Intergenic
1140346284 16:74216096-74216118 GGTCATGGGGGCAAGAGCTGGGG - Intergenic
1141529616 16:84637172-84637194 GCCCATGGGGGTGTGTTATGAGG + Intergenic
1141920115 16:87130025-87130047 TCTGATGGGGGTGAGTGGGGAGG - Intronic
1142848327 17:2692558-2692580 GCTGCTGGACGTGAGTGCTGGGG - Exonic
1142865751 17:2790565-2790587 GCTCCAGGGGGTTAGTACTGGGG + Intronic
1144959314 17:19035925-19035947 GCCCTTGGGGGTGTGTGCAGAGG - Intronic
1144975845 17:19138599-19138621 GCCCTTGGGGGTGTGTGCAGAGG + Intronic
1146053139 17:29567971-29567993 CCTCCTGGGGGTGAGGCCTGTGG + Intronic
1147019560 17:37520712-37520734 CCTGCTGGGGGTGAGTGATGAGG - Intronic
1147793649 17:43027924-43027946 CCTCATGTGGGAGAGTCCTGAGG + Intronic
1147969550 17:44212172-44212194 TCTCATGGGGGTGGGGGGTGGGG + Intronic
1148858813 17:50593481-50593503 GCTGAAAGGGCTGAGTGCTGGGG - Intronic
1149296752 17:55267950-55267972 GCCCAGGAGGGTGAGGGCTGTGG - Exonic
1150290140 17:63976438-63976460 GCTCATGGGGAGGAGCGCGGAGG - Intergenic
1151461984 17:74259897-74259919 GATGCTGGGGGTGTGTGCTGGGG + Intronic
1151463914 17:74272467-74272489 ACTCTTAGGGGTGGGTGCTGAGG - Intergenic
1151658090 17:75504912-75504934 GCGCAGGGGGGTGGGTGCGGAGG + Exonic
1153095884 18:1402283-1402305 GCTGATAGTGTTGAGTGCTGAGG - Intergenic
1153619977 18:6968237-6968259 ACTCACGGGGCTGAGCGCTGGGG - Intronic
1154344491 18:13530864-13530886 GGTCATGGTGGTGTGGGCTGGGG + Intronic
1155157308 18:23168444-23168466 GCTGCTGGGGGTGAGGGCAGGGG + Intronic
1155560725 18:27073393-27073415 GCTGATGGGGGTGGGGGGTGGGG + Intronic
1155593340 18:27453516-27453538 GCTCAGGTGTGTGAGTACTGAGG - Intergenic
1156913498 18:42438827-42438849 GCCCATGGTGATGAGGGCTGGGG - Intergenic
1159158261 18:64610618-64610640 GCCAATGGGAGTGAGTGCAGAGG + Intergenic
1160689802 19:456297-456319 GCTCCTGGGGGACAGCGCTGGGG + Intronic
1160761525 19:787821-787843 GCTCCTGGAGGTGACTGCTCAGG - Intergenic
1160822714 19:1066009-1066031 ACTCATGGCGCTGAGGGCTGGGG - Exonic
1160917241 19:1503175-1503197 GCTCCTGGCGGTGGGGGCTGTGG + Intergenic
1161407933 19:4100907-4100929 AGACATGGGGGTGAGAGCTGAGG + Intronic
1161706013 19:5822122-5822144 GTCCATGGGGGTGAGTGGGGTGG + Intergenic
1161949595 19:7460414-7460436 GCTTGGGAGGGTGAGTGCTGTGG - Intronic
1162250046 19:9435095-9435117 GCTCGTCGCGGTGAGTACTGGGG - Intronic
1163202004 19:15776362-15776384 GCTTGTGGTGGTGGGTGCTGGGG - Intergenic
1163848237 19:19649554-19649576 GCTGACGTGGGTGAGTGCTGTGG - Exonic
1165225639 19:34352854-34352876 GCTGGTGGGGGTGGGGGCTGGGG - Exonic
1165433032 19:35783107-35783129 TCTGATGGTGATGAGTGCTGAGG + Intronic
1165718398 19:38062007-38062029 ACTCATCGGGGTGAGGGGTGGGG - Intronic
1167596847 19:50432501-50432523 TCTCAAGGGGGTAAGGGCTGCGG - Intergenic
1168074578 19:53972916-53972938 CCTATTGGGGGTGAGTGATGGGG - Intronic
1168296211 19:55378366-55378388 GGTCGTGGGGGTGTGAGCTGAGG + Intergenic
1168303300 19:55419376-55419398 GCTCTTGGGGGTGAGGGGGGTGG + Intergenic
925460130 2:4055017-4055039 CCTCCTGTGGCTGAGTGCTGGGG - Intergenic
925929339 2:8694265-8694287 GCTGGTGGGGGAGAGGGCTGGGG + Intergenic
927095800 2:19746925-19746947 ACTCAGGTGGGTGAGTGATGAGG - Intergenic
927547971 2:23971627-23971649 GGGCATGGTGGTGTGTGCTGAGG - Intronic
927893208 2:26765206-26765228 GCTCATGTGGGTCAGGCCTGTGG - Intronic
927937355 2:27083297-27083319 GCCCATGGGGATGAGGGCTGTGG + Exonic
929555243 2:42921805-42921827 CCTCCAGGGGCTGAGTGCTGAGG - Intergenic
929789877 2:45014365-45014387 GCACAGGCGGGTCAGTGCTGGGG - Intergenic
932470079 2:71949281-71949303 AATCATGGCGGCGAGTGCTGCGG + Intergenic
933823735 2:86139518-86139540 GCAAATGGGGCTGAGTGCAGTGG + Exonic
935031651 2:99328686-99328708 GCTCATGAGGCTGGGTGCAGTGG + Intronic
937819194 2:126288602-126288624 TCTGATGAGGGTGAGTGCTCAGG + Intergenic
937873262 2:126801648-126801670 GGTCCTGGGGGGGAGTCCTGTGG - Intergenic
937974885 2:127576633-127576655 GCTCATGGGGGTGAGTGCTGAGG + Exonic
945362294 2:208906607-208906629 GCTACTGGGGGTGGGCGCTGTGG + Intergenic
947199941 2:227606204-227606226 GCTCATATGGCTGAGTGCGGTGG + Intergenic
947732456 2:232438981-232439003 GGTGCTGGGAGTGAGTGCTGAGG + Intergenic
947866258 2:233399838-233399860 GCTTATGGAGGTGAGAGATGGGG + Intronic
948272723 2:236686803-236686825 GCTCATTGGAGGGAGAGCTGAGG - Intergenic
948857777 2:240738228-240738250 GCTCATGGGTGTCAGTTTTGTGG - Intronic
1170559485 20:17544393-17544415 GCACATAGAGGTGAGTGCTGAGG + Intronic
1170990664 20:21299123-21299145 GGTAATGGGGGTGTGTCCTGAGG + Intergenic
1171425028 20:25043671-25043693 GCTGGTGGGGGTGATTTCTGTGG - Intronic
1172834588 20:37864793-37864815 GCTGACTGGGGTGCGTGCTGAGG + Intronic
1173001864 20:39110651-39110673 GCTCCTGGGGGCCAGGGCTGAGG - Intergenic
1174066931 20:47872550-47872572 GCCCAGGAGGGTGAGAGCTGGGG - Intergenic
1174275418 20:49400324-49400346 ACTCATGGGGGAGTGTGGTGAGG - Intronic
1175862496 20:62157783-62157805 ACCCCTGGGGGTGAGGGCTGCGG + Intronic
1175911075 20:62405884-62405906 ACTCCTGGAGGTGAGGGCTGTGG + Intronic
1176189191 20:63799765-63799787 TCTCATGGGGGAGCTTGCTGTGG - Intronic
1178221534 21:30666132-30666154 GATCATGGTGGTGAGTACTCTGG + Intergenic
1178283550 21:31305896-31305918 GCTCACGGGGGTGACTGCCATGG + Intronic
1179143865 21:38750935-38750957 GCTCAGGGTGATGAGAGCTGAGG + Intergenic
1179333360 21:40427084-40427106 GCTCATTGCAGAGAGTGCTGTGG - Intronic
1179654004 21:42834029-42834051 CCTCTGAGGGGTGAGTGCTGCGG - Intergenic
1179800937 21:43811252-43811274 GGTCTCGGGGGTGAGGGCTGAGG - Intergenic
1180946000 22:19693887-19693909 GGTCCTGGGGGTGAGGGCTTTGG - Intergenic
1181122943 22:20684453-20684475 GCTCATGGGGCTGGATGCAGTGG - Intergenic
1182097636 22:27636839-27636861 ACTGATGGGGGTGAGAGCTTTGG - Intergenic
1182289186 22:29265652-29265674 GGTCCTGGGGCTGTGTGCTGGGG + Exonic
1183292245 22:37010055-37010077 GGTGATGGGGCTGAATGCTGAGG - Intergenic
1183461756 22:37955249-37955271 GCTGATGGGGCCGGGTGCTGTGG + Intronic
1183510254 22:38230528-38230550 GCTTCGGGGGGTGGGTGCTGGGG + Intronic
1185071936 22:48661394-48661416 CCTCATCGGGGCGAGTTCTGCGG - Intronic
1185377123 22:50487781-50487803 GCTCATGGGGCTGAGGGCAAGGG - Intronic
950218596 3:11177564-11177586 GCTCAGGGGGACGAGTGCTGTGG - Intronic
953810168 3:46105285-46105307 AGTCATAGGGGAGAGTGCTGTGG - Intergenic
954480651 3:50796966-50796988 GCTGGTGGGGGTGGGGGCTGAGG + Intronic
954584486 3:51721383-51721405 GCTCATGGGGGTAGATGCAGTGG - Intergenic
954994287 3:54867269-54867291 ACTCATGGGGGTGAGGGGCGAGG + Intronic
956323586 3:68026213-68026235 GGTCATGGGAGTGAGGGCAGGGG + Intronic
958641655 3:96814022-96814044 GCTGGAGGGGGTGAGTGCCGTGG - Intergenic
960970310 3:123134804-123134826 GCTCCTGGGGGACAGGGCTGTGG - Intronic
960977129 3:123186228-123186250 GCTCAATGGGGTAAGGGCTGTGG + Intronic
961252087 3:125515758-125515780 GTTCTTGGGGCTGGGTGCTGTGG + Intronic
961480708 3:127177966-127177988 GCTCATGGGGCTGGGCGCGGTGG - Intergenic
962191475 3:133315482-133315504 TCTCATGGGTGTGGGGGCTGGGG - Intronic
963039089 3:141055644-141055666 GCTGACGGGGTTGAGTGGTGGGG + Intronic
963752563 3:149197923-149197945 GCCCATGGGGGTGTGTGTGGGGG + Intronic
965869995 3:173253481-173253503 GCTCATGTGGCTGGGTGCAGTGG - Intergenic
967028878 3:185587418-185587440 GCTTTTGGGGCTGAGTGCAGTGG - Intronic
967594887 3:191317098-191317120 GCCCATGGGGGTGGGGGCTCGGG + Intronic
968008925 3:195260432-195260454 GCCCAGGGGGGTCAGTGTTGCGG - Intronic
968274941 3:197433811-197433833 GGTTAAGGGAGTGAGTGCTGAGG + Intergenic
968569901 4:1333951-1333973 GGGCATGGGGGTGGGTGCAGGGG - Intronic
968569933 4:1334049-1334071 GGGCATGGGGGTGGGTGCAGGGG - Intronic
968600855 4:1508632-1508654 GCTCATGGGGGAGCCTCCTGGGG + Intergenic
969521976 4:7683637-7683659 GCCCATGGGAGTGAGGGCTGAGG + Intronic
973323282 4:48831422-48831444 GCTTCTGGGGGTGTGAGCTGGGG + Exonic
974080016 4:57202514-57202536 GGGCATGGTGGTGTGTGCTGTGG + Intergenic
977335470 4:95693198-95693220 ACTCATGTGGATGAATGCTGGGG - Intergenic
978918387 4:114151988-114152010 GGTAATGGGGGTGGGTCCTGGGG - Intergenic
981610520 4:146589542-146589564 TCACATGAGGGTAAGTGCTGTGG + Intergenic
983014602 4:162597189-162597211 GATCAAGGTGGTGACTGCTGAGG + Intergenic
984789582 4:183603234-183603256 GTACATGGGGCTGGGTGCTGTGG + Intergenic
985493817 5:193534-193556 GCACCTGGTGGTGAGTCCTGGGG + Intronic
985539107 5:479598-479620 GCTGGTGGGGGTGAGCGCTGAGG - Intronic
986028684 5:3874887-3874909 GCTCATGCTGTAGAGTGCTGTGG + Intergenic
987747858 5:22000247-22000269 GCACATGGGGCTGAGTGTGGTGG - Intronic
991090630 5:62690642-62690664 GGTCATGGTGGGGAGTGCTGGGG + Intergenic
991576723 5:68112247-68112269 GTGCATGGGGGTGGCTGCTGGGG + Intergenic
991768037 5:70010039-70010061 GCACATGGGGCTGAGTGTGGTGG - Intergenic
991847273 5:70885117-70885139 GCACATGGGGCTGAGTGTGGTGG - Intergenic
991962749 5:72062208-72062230 ACTCCTGGGGGTGAGTGCAGTGG - Intergenic
992185681 5:74242123-74242145 GATCATGGTGGTGGGGGCTGGGG - Intergenic
993137549 5:83989309-83989331 GCTCATGGGGGTGGGGGCAGGGG - Intronic
996035467 5:118753772-118753794 GCTCAGGTGGGTGAGGGTTGTGG - Intergenic
996626248 5:125573434-125573456 TCTTGTGGGGGTGAGAGCTGTGG - Intergenic
999076237 5:148798353-148798375 GCTCATGGGGTTGGTTACTGTGG + Intergenic
999406682 5:151312894-151312916 GCCCATGGTGGTGAGGCCTGTGG + Intergenic
1000504265 5:162094556-162094578 GCTCATGAGGCTGAATGCTTAGG + Intronic
1002100204 5:176853817-176853839 GCTATTGGGGGTGACTGCTAGGG + Intronic
1002201568 5:177531570-177531592 GCCCGTGGGAGGGAGTGCTGTGG - Intronic
1002252509 5:177938572-177938594 CCTCATGGGGGGGAGTGTGGAGG - Intergenic
1003797523 6:9621567-9621589 GCTCATAGGGCTGAGTAATGAGG - Intronic
1006140876 6:31928908-31928930 GATAATGGGGGTGAGTTCTCTGG + Exonic
1006507114 6:34496382-34496404 GCTGAGGGGGGTGGGGGCTGAGG + Intronic
1007733962 6:43968816-43968838 GGTTGTGGGGGTGGGTGCTGTGG - Intergenic
1008159469 6:48059765-48059787 AGTGATGGTGGTGAGTGCTGAGG - Intronic
1009806159 6:68604359-68604381 GCTGTTGGGGGTGGGTCCTGTGG - Intergenic
1010765857 6:79776903-79776925 GGTCAAGGGGAGGAGTGCTGAGG - Intergenic
1012381493 6:98624695-98624717 ACTCATTGTGGTAAGTGCTGTGG - Intergenic
1013226895 6:108125746-108125768 GCTCATGGGGGTAGGAGGTGAGG + Intronic
1018684941 6:166297007-166297029 GCTCATGGGGTTCAGTGCTGGGG + Intergenic
1018856804 6:167680857-167680879 GCTCAGGAGCGTGAATGCTGAGG + Intergenic
1019398371 7:835896-835918 TCTCATGGGGGTGTTGGCTGTGG + Intronic
1020481643 7:8669161-8669183 GCTGGTGTGGGTGTGTGCTGGGG + Intronic
1021538454 7:21730854-21730876 GCACATGGGGCTGGGTGCAGTGG + Intronic
1022210071 7:28199840-28199862 GCACATGGGGCTGGGTGCAGTGG - Intergenic
1023725978 7:43142923-43142945 GCTCAGAGTGGTGGGTGCTGTGG + Intronic
1023965286 7:44960898-44960920 GCTGATGGGGCTGAGGGCTGAGG + Intergenic
1023965304 7:44960947-44960969 GCTCAAGGGGCTGAGGGCTGAGG + Intergenic
1023965334 7:44961029-44961051 GCTGAAGGGGCTGAGGGCTGAGG + Intergenic
1023965394 7:44961227-44961249 GCTGAGGGGGGTAAGGGCTGAGG + Intergenic
1023965439 7:44961348-44961370 GCTGAGGGGGGTAAGGGCTGAGG + Intergenic
1023965552 7:44961673-44961695 GCTGAGGGGGCTGAGGGCTGAGG + Intergenic
1023990587 7:45126135-45126157 ACTCCTGGGGGTGGGTGGTGGGG - Intergenic
1026370219 7:69691410-69691432 GAGGATGGGGGTGGGTGCTGAGG - Intronic
1026678745 7:72449534-72449556 GCCAGTGGGGGTGAGGGCTGTGG - Intergenic
1026773815 7:73218821-73218843 TCTCCTGGGGGTGAGGGTTGAGG - Intergenic
1027014672 7:74772211-74772233 TCTCCTGGGGGTGAGGGTTGAGG - Intergenic
1027073359 7:75173744-75173766 TCTCCTGGGGGTGAGGGTTGAGG + Intergenic
1028895865 7:96040861-96040883 GGGCATGGTGGTGTGTGCTGTGG - Intronic
1029730407 7:102434495-102434517 GCTCAGGGCAGTGAGGGCTGAGG - Intronic
1033126524 7:138711840-138711862 GCTCATGGGTGTCTGTGCTGCGG - Intronic
1033347614 7:140538225-140538247 GTTTGTGGGGGAGAGTGCTGCGG + Intronic
1034056964 7:148045315-148045337 TCTAATGGGGGTGGGTGGTGGGG + Intronic
1034415363 7:150961781-150961803 GGTCAAGGGGCTGCGTGCTGGGG + Intronic
1034526763 7:151668908-151668930 GAGCATGGGAGTGACTGCTGTGG + Intronic
1034937694 7:155210395-155210417 CCTCATGGGGGTGGGTGGTGAGG + Intergenic
1035918510 8:3651844-3651866 GCTCATGGTGGTAAGTGCGATGG - Intronic
1038015178 8:23508805-23508827 TCTAATGAGGGTGTGTGCTGGGG + Intergenic
1038150741 8:24941120-24941142 ACTCATGGGGGCGAGGGGTGGGG - Intergenic
1038561866 8:28587852-28587874 TCTCTTGGGTGTGACTGCTGGGG + Intergenic
1039440987 8:37595196-37595218 GCTCTTGGGGGTTGGAGCTGAGG - Intergenic
1039518711 8:38153473-38153495 TCTGCTGGAGGTGAGTGCTGAGG - Intergenic
1039616526 8:38958895-38958917 GCGCAGGGGAGGGAGTGCTGGGG + Intronic
1039798414 8:40934473-40934495 GCTCATGAGGGTGTGTGACGTGG + Intergenic
1039971108 8:42322489-42322511 GCTTGTGTGAGTGAGTGCTGTGG + Exonic
1041047307 8:53899881-53899903 GCTGAGGGCGGTGAGTGGTGAGG - Intronic
1042468698 8:69159198-69159220 GATGATGGGGATGAGTGCTGAGG - Intergenic
1043608871 8:82036713-82036735 GCTCATGGGGTTAAGGGCTGAGG + Intergenic
1047232536 8:123009637-123009659 GCTAATGGGTATGAGTACTGGGG - Intergenic
1049502321 8:142974114-142974136 GACCATGGGGGCGAATGCTGGGG + Intergenic
1049688992 8:143950586-143950608 GCACATGGGGGTGCAAGCTGCGG + Exonic
1049879532 8:145052488-145052510 GCGCATGGCGGTGAGCGGTGTGG + Exonic
1050351073 9:4741455-4741477 GCGCGTGGGGGTGGGTGCAGAGG - Intronic
1051729518 9:20125711-20125733 GCCCATGGTGGTGAGGGTTGTGG + Intergenic
1052101274 9:24448719-24448741 CATGATGGGGGTGAGTCCTGAGG + Intergenic
1053137427 9:35660130-35660152 GCTCTGGTGGCTGAGTGCTGTGG - Exonic
1053876913 9:42554275-42554297 TCTCATGGGGCTCAGTGCAGAGG - Intergenic
1053895763 9:42740432-42740454 TCTCATGGGGCTCAGTGCAGAGG + Intergenic
1054234785 9:62547447-62547469 TCTCATGGGGCTCAGTGCAGAGG + Intergenic
1055836864 9:80454104-80454126 CCTGTTGGGGGTGAGTGGTGAGG + Intergenic
1056488936 9:87086070-87086092 GCTCATGGTGGTGCTTGCTTAGG - Intergenic
1056899479 9:90584593-90584615 GCTCATCGGGGTGTGGGCTGGGG - Intergenic
1057215811 9:93228184-93228206 GCCCATGAGGGTGTGTGCTGTGG + Intronic
1057391738 9:94646317-94646339 GCTGATGACGGTGGGTGCTGTGG - Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1058924033 9:109644077-109644099 GGTCCTGGGGGTGAATCCTGGGG - Intronic
1059592489 9:115677241-115677263 GATCATGGGGATGGGTCCTGAGG - Intergenic
1060018316 9:120106755-120106777 GATCATGGGAGTGAGGGTTGAGG - Intergenic
1060402481 9:123356625-123356647 GCTGATGCGGGTGAGGGATGGGG + Intronic
1060509130 9:124219296-124219318 GCTCATGAGGGGCAGAGCTGGGG - Intergenic
1060933624 9:127503803-127503825 GCTGATGGGGGTAAATGCTCAGG + Intergenic
1060960672 9:127678523-127678545 CATCATGGAGGTTAGTGCTGGGG + Exonic
1061059691 9:128244313-128244335 GCTCATGTGTGTGAGTTCTGGGG + Intronic
1061899455 9:133665633-133665655 GCCCATGGGGCTGAGTCCGGCGG - Intronic
1186452893 X:9687964-9687986 GCTCACGGGGGTGAGGGCTCTGG - Intronic
1186467532 X:9795664-9795686 GTGCATGGGGGTGAGTGATCAGG + Intronic
1188363038 X:29280507-29280529 GCTAATAAGGGTGAGTGCTGGGG - Intronic
1188729889 X:33632656-33632678 GGTAGTGGGGGTGAGTGGTGGGG + Intergenic
1189974487 X:46447566-46447588 GCCTGTGGGCGTGAGTGCTGGGG + Intronic
1190224447 X:48534483-48534505 GCCTGTGGGGGTGAGTGATGGGG - Intergenic
1191671392 X:63751837-63751859 GTTCATGGGGGTGTGTGGGGGGG - Intronic
1192358203 X:70423002-70423024 GCTCAGGGAGGCGAGGGCTGAGG - Intergenic
1192563607 X:72144254-72144276 GCTAATGGGGGTGGGTGGGGGGG - Intergenic
1193214588 X:78848576-78848598 GCTCATGTGGGTGTGTGCCTTGG + Intergenic
1193466044 X:81848995-81849017 GGTCATTGGGGTGAGTCCTCAGG - Intergenic
1195129204 X:101837955-101837977 ACTCATGGGGCTGAGTCCTTGGG + Intronic
1195594629 X:106673813-106673835 GCTCATGGTGGTGAGGCTTGTGG + Intronic
1195984652 X:110615598-110615620 GCTCATGGTGGTGAGGCTTGTGG + Intergenic
1196018778 X:110967313-110967335 GCTGGAGGGGGTTAGTGCTGAGG + Intronic
1198440455 X:136658229-136658251 ACTGATGGGGGTGAGGGTTGAGG - Intronic