ID: 937977387

View in Genome Browser
Species Human (GRCh38)
Location 2:127589888-127589910
Sequence GTGTGTGAGTGGATGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2673
Summary {0: 1, 1: 1, 2: 17, 3: 286, 4: 2368}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937977387 Original CRISPR GTGTGTGAGTGGATGGGTGA AGG Intronic
Too many off-targets to display for this crispr