ID: 937977513

View in Genome Browser
Species Human (GRCh38)
Location 2:127590651-127590673
Sequence CTGTCTGCAGGGCTGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937977513_937977522 9 Left 937977513 2:127590651-127590673 CCTTTCACCAGCCCTGCAGACAG No data
Right 937977522 2:127590683-127590705 CCTGCTGTGAGACGGTGAGGGGG No data
937977513_937977518 6 Left 937977513 2:127590651-127590673 CCTTTCACCAGCCCTGCAGACAG No data
Right 937977518 2:127590680-127590702 TTACCTGCTGTGAGACGGTGAGG No data
937977513_937977520 8 Left 937977513 2:127590651-127590673 CCTTTCACCAGCCCTGCAGACAG No data
Right 937977520 2:127590682-127590704 ACCTGCTGTGAGACGGTGAGGGG No data
937977513_937977519 7 Left 937977513 2:127590651-127590673 CCTTTCACCAGCCCTGCAGACAG No data
Right 937977519 2:127590681-127590703 TACCTGCTGTGAGACGGTGAGGG No data
937977513_937977517 1 Left 937977513 2:127590651-127590673 CCTTTCACCAGCCCTGCAGACAG No data
Right 937977517 2:127590675-127590697 CAGCTTTACCTGCTGTGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937977513 Original CRISPR CTGTCTGCAGGGCTGGTGAA AGG (reversed) Intronic
No off target data available for this crispr