ID: 937983504

View in Genome Browser
Species Human (GRCh38)
Location 2:127628318-127628340
Sequence CTGGATCAGGGGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 557}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937983487_937983504 7 Left 937983487 2:127628288-127628310 CCAACCCCACCTCCCGAGGCTGT 0: 1
1: 0
2: 1
3: 27
4: 364
Right 937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 58
4: 557
937983497_937983504 -6 Left 937983497 2:127628301-127628323 CCGAGGCTGTTTAGGGGCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 58
4: 557
937983488_937983504 3 Left 937983488 2:127628292-127628314 CCCCACCTCCCGAGGCTGTTTAG 0: 1
1: 0
2: 3
3: 8
4: 110
Right 937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 58
4: 557
937983486_937983504 8 Left 937983486 2:127628287-127628309 CCCAACCCCACCTCCCGAGGCTG 0: 1
1: 0
2: 2
3: 33
4: 563
Right 937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 58
4: 557
937983482_937983504 29 Left 937983482 2:127628266-127628288 CCTCATCTGTGACTCAGGACCCC 0: 1
1: 0
2: 2
3: 25
4: 227
Right 937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 58
4: 557
937983494_937983504 -2 Left 937983494 2:127628297-127628319 CCTCCCGAGGCTGTTTAGGGGCT 0: 1
1: 0
2: 0
3: 4
4: 90
Right 937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 58
4: 557
937983491_937983504 1 Left 937983491 2:127628294-127628316 CCACCTCCCGAGGCTGTTTAGGG 0: 1
1: 0
2: 1
3: 15
4: 133
Right 937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 58
4: 557
937983496_937983504 -5 Left 937983496 2:127628300-127628322 CCCGAGGCTGTTTAGGGGCTGGA 0: 1
1: 0
2: 6
3: 26
4: 224
Right 937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 58
4: 557
937983485_937983504 9 Left 937983485 2:127628286-127628308 CCCCAACCCCACCTCCCGAGGCT 0: 1
1: 0
2: 3
3: 50
4: 501
Right 937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 58
4: 557
937983489_937983504 2 Left 937983489 2:127628293-127628315 CCCACCTCCCGAGGCTGTTTAGG 0: 1
1: 0
2: 2
3: 10
4: 121
Right 937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 58
4: 557
937983484_937983504 10 Left 937983484 2:127628285-127628307 CCCCCAACCCCACCTCCCGAGGC 0: 1
1: 0
2: 6
3: 73
4: 678
Right 937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 58
4: 557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937983504 Original CRISPR CTGGATCAGGGGAAGGTGGA GGG Intronic
900088220 1:908665-908687 GGGGATGAGGGGAAGGTGGGAGG + Intergenic
900241726 1:1620527-1620549 GTGGATCTGGTGGAGGTGGACGG + Intronic
901006675 1:6175066-6175088 ATGGATGAGTGGATGGTGGATGG + Intronic
901006731 1:6175341-6175363 ATGGATGAGTGGATGGTGGATGG + Intronic
901169543 1:7246628-7246650 AGGGATCAGAGGAAGGAGGAGGG - Intronic
901551204 1:9997379-9997401 CGGGATCAGGCGAAGGCGGCCGG + Intronic
901913858 1:12482265-12482287 CTGGATAAGGGGAGGCTGGGTGG - Intronic
901932044 1:12602183-12602205 CTTGTGCAGGGGAAGTTGGATGG + Intronic
902266161 1:15266751-15266773 AGGGGTCAGGGGAAGGTGGGGGG - Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902655348 1:17864071-17864093 CTGGATGAGGTGACAGTGGATGG + Intergenic
902770739 1:18644074-18644096 CTGGAAGAGGGGAAAGTGGCCGG - Intronic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
902885361 1:19400883-19400905 CAGGATCGGGGCAAGGTGGTAGG - Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904273398 1:29364942-29364964 CTGGCTCAGGGGCAGGCAGATGG + Intergenic
904389476 1:30172499-30172521 CTAGATCAGAGGAAAGTGGATGG + Intergenic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
905028651 1:34867192-34867214 CTGCAACAGAGGAAGATGGAGGG + Intronic
906561474 1:46761150-46761172 CAGTATCAAGGGAGGGTGGAGGG + Intronic
906662174 1:47590719-47590741 CTGGTACATGGGAAGGTGGGAGG + Intergenic
906940671 1:50252524-50252546 CTGGATAATGGGGAGGGGGAAGG + Intergenic
908077436 1:60535819-60535841 CTGGAATAGGGGCATGTGGATGG + Intergenic
909162196 1:72166753-72166775 CAGGATCTGGGGAAGACGGATGG + Intronic
909800896 1:79806192-79806214 CTGGAAGAGGGGAATATGGAGGG + Intergenic
910211693 1:84800251-84800273 ATGGAGCAGAGGAAGGGGGAAGG + Intergenic
910629378 1:89340269-89340291 CTGCATCGGGGGAAACTGGAAGG + Intergenic
910929687 1:92430905-92430927 TGGGATCAGGGGAATGGGGAGGG - Intergenic
911242767 1:95483469-95483491 CTGGAGCTGGGGATGCTGGATGG + Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
912666011 1:111580328-111580350 ATGGAGCATGGGAAGGTGGGAGG + Intronic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
914919307 1:151837012-151837034 CCGGCTCCTGGGAAGGTGGAGGG + Intergenic
915147090 1:153801690-153801712 CGGGAGCAGGGGAATGTGAAGGG - Intergenic
915597051 1:156901860-156901882 CTGGAGCAGGGCAGGGTGGGAGG + Intronic
917329562 1:173868087-173868109 CTGGATGAGAGGAAGATTGAGGG - Intronic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
920203019 1:204272039-204272061 CTTAATCCGGGGAAGGGGGAGGG - Intronic
920297341 1:204967118-204967140 CAGGACAAGGGAAAGGTGGAGGG - Intronic
921092921 1:211860222-211860244 CAGGACCAGGGGAAGAAGGAAGG + Intergenic
922013692 1:221620873-221620895 CTGGAAGAGGGCCAGGTGGATGG - Intergenic
922196824 1:223365728-223365750 CAGGACCTTGGGAAGGTGGATGG - Intergenic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
923759584 1:236828855-236828877 GTGGATGTGGGGAAGATGGAAGG + Intronic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1062790517 10:301395-301417 TGGGGTCTGGGGAAGGTGGAGGG + Intronic
1062940189 10:1415058-1415080 GTGGATCATGGGTGGGTGGATGG + Intronic
1063131471 10:3181546-3181568 CCGTATCAGGGGATGGAGGAAGG + Intergenic
1064323860 10:14330767-14330789 GTAGATCTGGGGAAGGTGGAAGG - Exonic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1066076291 10:31881032-31881054 ATGGAGGAGGGGAAGGTGGGGGG - Intronic
1067019123 10:42780041-42780063 CTGGAGCAGGAAAAGGTGGTGGG + Intergenic
1067056203 10:43053100-43053122 CTAGAGGAGAGGAAGGTGGAGGG - Intergenic
1067148512 10:43710841-43710863 GTGGACCAGGGGTAGGTGGCAGG + Intergenic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1067713622 10:48670788-48670810 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1068109626 10:52664588-52664610 CTGGAGCAGAGGAAGGGGAAGGG + Intergenic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1070133051 10:73668095-73668117 CTGTATCCGGGAAAGGAGGATGG + Intergenic
1070232659 10:74586245-74586267 CAAGATCAGAGGAAGGTGGGAGG + Intronic
1070844158 10:79508151-79508173 CTGGAGGAGGGAAAGGTGCAAGG - Intergenic
1070929639 10:80252160-80252182 CTGGAGGAGGGAAAGGTGCAAGG + Intergenic
1071858014 10:89645178-89645200 GGGGATCAGGGGAAGGCGGGCGG - Exonic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1073420243 10:103418654-103418676 GTGGAGCAGAGGAAGGTGGGGGG + Intronic
1073572094 10:104589297-104589319 CTGGATGATGGCAAGGTGCATGG + Intergenic
1074516929 10:114179197-114179219 CTGCTTCCGGGGAAGGCGGAGGG + Intergenic
1074957290 10:118404624-118404646 CTTGATAAATGGAAGGTGGAGGG + Intergenic
1075011559 10:118874733-118874755 CTGAAACAGGGGAATGTGGATGG + Intergenic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075574763 10:123570403-123570425 CAGGCTCTGGGGAAGGAGGAAGG - Intergenic
1076029334 10:127144078-127144100 CTAGAGCAGTGGAAGGTGGGCGG - Intronic
1076338663 10:129727965-129727987 CTGGAGCAGGGGAGGGTGTGAGG + Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076890436 10:133280716-133280738 GTGGACCAGGGGAGGGTGCAGGG + Intronic
1077159031 11:1104257-1104279 CTGGCTCCCGGGAAGGTGCAGGG + Intergenic
1077614068 11:3662440-3662462 GTGGATCAGAGGAAGCTGGGGGG - Intronic
1079089016 11:17467774-17467796 CTAGAACAGGGAAAAGTGGAGGG - Intronic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1080870975 11:36236787-36236809 CTGGAGCAGGGTAAGGGAGAAGG - Intergenic
1081650294 11:44819100-44819122 CTGGATCTGGGGAAGGAGTCAGG + Intronic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081747057 11:45480767-45480789 CAGGATGATGGGAAGGTGGTGGG + Intergenic
1081810511 11:45911435-45911457 TTGGTTCAGGGGAAGGGGCAAGG + Intronic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG + Intronic
1083680203 11:64348287-64348309 TTGGAGCAGGAGAAGGTGGCTGG + Intronic
1084026888 11:66456155-66456177 CTGGAGCAGGGGAGGGAGGGAGG + Intronic
1084043180 11:66554513-66554535 CTGGGTCGGGGGGAGGTGGGAGG - Intronic
1084785641 11:71440331-71440353 ATGGATGACGGGCAGGTGGATGG + Intronic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085532952 11:77202537-77202559 CTGGGTCAGAGGGAGCTGGAGGG + Intronic
1085547276 11:77331635-77331657 TGGGGTCAGGGGAGGGTGGAGGG + Intronic
1086089696 11:82993160-82993182 CTGGAGCAAGGAAAGGAGGAAGG - Intronic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1088655536 11:111995840-111995862 CTCAATCAGGGGTAGGTGGGAGG - Intronic
1088710878 11:112507447-112507469 TAGGCTCTGGGGAAGGTGGAAGG - Intergenic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1089733135 11:120532024-120532046 CTGGATGTGGGGCAGGTGGAAGG + Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1091048849 11:132349822-132349844 CTGGATTATGGAGAGGTGGAGGG + Intergenic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1091969973 12:4779078-4779100 AGGGATCAGAGGAAGGTGGGAGG - Intronic
1092763296 12:11829012-11829034 CTGGATCAGGGAGAGGTTGGAGG - Intronic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1093971706 12:25382108-25382130 CTGGCACAGGGCAAGGTGTATGG - Intergenic
1094040310 12:26114615-26114637 CTGGAGCAGGGAAGGGAGGAAGG + Intergenic
1094754643 12:33453872-33453894 CAGGATCTGGGGAAGGGGGCAGG + Intergenic
1095977632 12:47950492-47950514 CTAGACCAGTGGAATGTGGAGGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096542748 12:52317415-52317437 CTGGCTCAGGGGAAGGATGCAGG + Intronic
1096750262 12:53754117-53754139 ATGGATAATGGGAAGATGGAAGG + Intergenic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1096846536 12:54410228-54410250 GTGGAGCAGGGGCAGGAGGATGG + Intronic
1097797674 12:63880973-63880995 CCGGATCAGGAGTAGGGGGAGGG + Intronic
1099464441 12:82965772-82965794 CTGGATCAGAACAAGGGGGAGGG - Intronic
1099954947 12:89344683-89344705 GTGGGTCAGGGGAAAGGGGAAGG - Intergenic
1101569047 12:105936438-105936460 CTGGATAAAGCAAAGGTGGAAGG + Intergenic
1101652862 12:106693610-106693632 TGGGATCAGGGGACAGTGGAGGG + Intronic
1102425777 12:112843391-112843413 CTGGAGCAGAGGATGGGGGAAGG + Intronic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1103002469 12:117395851-117395873 CTGGATAATGGAAAGATGGATGG - Intronic
1103359501 12:120345572-120345594 CTGAAGCAGGGGACGGTGGCAGG - Exonic
1103477933 12:121232376-121232398 ATGGATCAGGGGGAGATGGCTGG - Intronic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1104714204 12:131005753-131005775 CTGGCTCAGGGGATGGAGCAGGG + Intronic
1105267321 13:18832884-18832906 CTACAACAGGGGTAGGTGGAGGG + Intergenic
1107440741 13:40425387-40425409 CTGGAGCAGGGTGAGGTGGAGGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1112676407 13:101707354-101707376 GTGGAGCAGGGGAAGATTGAAGG + Intronic
1112912995 13:104511751-104511773 ATAGGTCAGGGGAAGGGGGAGGG - Intergenic
1113879264 13:113614563-113614585 GTGGATCAGGGGAAGGTAGAGGG + Intronic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114645830 14:24255579-24255601 TGGGATCAGGGGAAGGAGGCCGG - Intronic
1114980421 14:28157649-28157671 CTGGATGAGGGGAACGTGGTGGG + Intergenic
1116131206 14:40856909-40856931 AGGGATCAAGGGAAGGAGGATGG + Intergenic
1117019930 14:51559715-51559737 CTTGATTAGGGAAAGATGGATGG - Intronic
1117508309 14:56424233-56424255 CTGGATCAAGGGAAGGTGAGGGG + Intergenic
1117833306 14:59776407-59776429 CTGCATCATGGCATGGTGGAAGG - Intronic
1118071184 14:62248313-62248335 CTGAATCTGTGGAAGGTGCAGGG - Intergenic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119391776 14:74295863-74295885 GTGCATCAGGAGAAGCTGGAGGG - Exonic
1119806635 14:77486465-77486487 GTGGATGAGTGGAAGGTGGAAGG + Intronic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1122059022 14:99124412-99124434 GTGGAGAAGGGGAAGGTGCATGG - Intergenic
1122457412 14:101865103-101865125 CTGGTTCAGGGGAAAGAGCATGG + Intronic
1122600746 14:102920520-102920542 GTGGATGAAGGGATGGTGGATGG - Intergenic
1122600791 14:102920718-102920740 GTGGATAAGTGGATGGTGGATGG - Intergenic
1122628498 14:103096873-103096895 TGTGATCAGGTGAAGGTGGATGG + Intergenic
1122879928 14:104686117-104686139 GTGGATGATGGGTAGGTGGATGG + Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124687291 15:31793136-31793158 CTGCTTCCGGGGAAGGTGCATGG - Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125514314 15:40309222-40309244 CTGGTCCAGGGCAGGGTGGAGGG + Intergenic
1125790482 15:42361765-42361787 CAGGATCTGGGGAAAGAGGATGG - Intronic
1126492328 15:49251660-49251682 CTGGTGCAGGGTGAGGTGGATGG - Intronic
1126554745 15:49973174-49973196 ACAGATCAGGGGAAGGGGGATGG + Intronic
1128156888 15:65396761-65396783 ATAGAGCAGGGGGAGGTGGACGG - Intronic
1128334174 15:66775535-66775557 CTGGATCAGGGCCAGGAGGCAGG + Intronic
1128665220 15:69532584-69532606 CTTGAACAGAGGAAGGTGTAGGG + Intergenic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129171756 15:73812277-73812299 CAGGATCAGGGGATGGGGGCTGG - Intergenic
1129297620 15:74608618-74608640 CTGGCCCAGGGGCAGGTGGGAGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129741640 15:77992384-77992406 CTGGAGCAGGGGGAGGTGGCGGG + Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1131559140 15:93424347-93424369 CTGGCCCAGGGGGTGGTGGAGGG - Intergenic
1131993293 15:98110539-98110561 CTGGATCAGGGGAACTTCAAGGG + Intergenic
1132749326 16:1450259-1450281 CTGGACCAGGCGAAGGTAGGGGG - Intronic
1132815196 16:1822493-1822515 CTGGAGCAGGGCAAGCTGGCAGG - Intronic
1132997682 16:2831703-2831725 CTGCATCCCGGGAAGGAGGATGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1135416087 16:22268988-22269010 GAGGATGTGGGGAAGGTGGAAGG - Intronic
1135771932 16:25224419-25224441 CAGGAGCAGGGGCAGGTGGCAGG + Exonic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136062819 16:27738261-27738283 CTGGAGCCAGGGAAGGAGGAAGG + Intronic
1136367220 16:29814345-29814367 CTGCAGCAGGGGGACGTGGACGG + Exonic
1136478665 16:30527740-30527762 CAGGCGCTGGGGAAGGTGGAGGG - Intronic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1138489846 16:57370399-57370421 CTGGACCTGGGGAGGGTAGAGGG + Intergenic
1138544191 16:57706296-57706318 CTGGATCAGAGGATGGTGGGAGG - Intronic
1138751187 16:59423251-59423273 AGGGATCATGGGTAGGTGGAGGG - Intergenic
1140028169 16:71311090-71311112 CTGGATCAGGGCTCGGTGGCCGG - Intergenic
1140118198 16:72060935-72060957 CTGGAAGAGGGCAAAGTGGACGG + Exonic
1140120231 16:72077126-72077148 CTGGAAGAGGGCAAAGTGGACGG + Exonic
1140194290 16:72844131-72844153 CTGGATCAGGGTGAGGTCCAAGG + Intronic
1140510237 16:75502322-75502344 CTGGACCACGGGATGCTGGAGGG + Intergenic
1140516003 16:75542388-75542410 CTGGACCATGGGATGCTGGAGGG + Intronic
1140728521 16:77835431-77835453 CTGGACCATGGGATGATGGATGG - Intronic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1141177448 16:81730364-81730386 CGGGATCTCGGGAAGGTGGCAGG + Intergenic
1141473688 16:84257474-84257496 TAGGAACTGGGGAAGGTGGAGGG - Intergenic
1141641992 16:85346833-85346855 ATGGATGATGGGCAGGTGGATGG + Intergenic
1142347234 16:89561563-89561585 CTGGTTCTGGGGCAGGTGGCCGG + Exonic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1144122751 17:12172307-12172329 CTGGGTCGGGGGCAGGGGGATGG - Intergenic
1144429124 17:15174352-15174374 CTGGACCAGGAGAAGGTTGTAGG + Intergenic
1144467680 17:15509312-15509334 CTGGACCAAGGGGAGGTGGTAGG + Intronic
1144582361 17:16466150-16466172 CTGGCTTAGGGGAGGGGGGATGG - Intronic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1144914768 17:18715322-18715344 CTTGAGCAGGGGGTGGTGGATGG - Intronic
1145062946 17:19743854-19743876 CTGGATCCGGGCAGGGTGGAGGG + Intronic
1145275512 17:21427023-21427045 CTGGTTCAGAGCAAGGGGGATGG - Intergenic
1145313363 17:21712917-21712939 CTGGTTCAGTGCAAGGGGGATGG - Intergenic
1145711811 17:26984873-26984895 CTGGTTCAGAGCAAGGGGGATGG - Intergenic
1146092585 17:29894826-29894848 CTTAATTGGGGGAAGGTGGAAGG - Intronic
1147341704 17:39756323-39756345 CTGGCCCAAGGGATGGTGGAGGG - Intergenic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1147877669 17:43632847-43632869 CAGGATGAAGGGAGGGTGGACGG + Intergenic
1147924693 17:43939091-43939113 GTGGAGTGGGGGAAGGTGGATGG - Intergenic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148001303 17:44389102-44389124 CTGGCTCAGGTGAAGGTATAAGG - Intronic
1148323342 17:46770401-46770423 CTGGACTTTGGGAAGGTGGAGGG - Intronic
1148548344 17:48533630-48533652 CGGGATGAGGAAAAGGTGGAAGG - Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149542231 17:57476318-57476340 CAGGCTCAGGGGAAGGTGCCAGG - Intronic
1149624402 17:58069874-58069896 CTGGATCAGTTGAGGGTTGAGGG + Intergenic
1150675525 17:67244199-67244221 CTGGAGCGGGGGAAGGAGGGAGG - Intronic
1151066808 17:71160252-71160274 CTGGATCAGGGAAAGCTTAAAGG - Intergenic
1151190494 17:72394470-72394492 CAGGCTCATGGGAAGTTGGAAGG + Intergenic
1151507962 17:74541791-74541813 AAGGGTCAGGGGATGGTGGAGGG - Intronic
1151875889 17:76868236-76868258 TTGGCTCAGGGGAAGGAGCAGGG + Intergenic
1152550523 17:81027757-81027779 CTGGAGCTGGGCAGGGTGGAGGG - Intergenic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1152962135 18:86384-86406 CTTCATCAGGTGAGGGTGGAGGG - Intergenic
1154336703 18:13471635-13471657 GTGGAGCTGGGGAGGGTGGAGGG + Intronic
1154421092 18:14228546-14228568 CTACAACAGGGGTAGGTGGAGGG - Intergenic
1155200286 18:23511319-23511341 CTTGAGCAGGGGAGGGTGGGAGG + Intronic
1156591230 18:38490945-38490967 GTGGAACAGGGGCAGGAGGAAGG - Intergenic
1156664575 18:39390076-39390098 CTGGAGCCAGGGAAGCTGGATGG + Intergenic
1157182867 18:45512802-45512824 CTGGATTGGGGGGAGCTGGAAGG + Intronic
1157335430 18:46734031-46734053 CTGGACCTGGGGATGGTGGAGGG - Intronic
1157630815 18:49093395-49093417 CTGGATCAGAGCAGGGTGTAAGG + Intronic
1157687379 18:49653100-49653122 CTGGATGCAGGGGAGGTGGAAGG - Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157808036 18:50672780-50672802 CTGGATCAAGGGGAGGAGCAAGG + Intronic
1157929378 18:51804301-51804323 CTGGCTCTGGGGAATATGGATGG + Intergenic
1160506073 18:79427494-79427516 GTGGGTCGGGGGAAGCTGGACGG + Intronic
1161379850 19:3959123-3959145 CTGGAGCAGGAGAAGCTGCAGGG - Exonic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1162540807 19:11294890-11294912 ATGGATTGGGGGAAGGCGGATGG - Intergenic
1162802451 19:13118731-13118753 GGGGATCCGGGGAAGTTGGAGGG + Intronic
1162809319 19:13154677-13154699 CTGAATCACGAGAATGTGGAGGG + Exonic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163171641 19:15535586-15535608 GTGGATAGGTGGAAGGTGGATGG - Intronic
1163468752 19:17484923-17484945 CTGAAACAGGGGCAGGTGGGTGG + Intronic
1163609980 19:18295650-18295672 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609990 19:18295695-18295717 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163610009 19:18295776-18295798 GTGGATGAGTGGATGGTGGATGG - Intergenic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164563961 19:29312616-29312638 GTGGAGCAGGGGGAGGTGGGAGG + Intergenic
1164871424 19:31647506-31647528 CTGCTTCTGGGGAAGGTGCAGGG + Intergenic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165164500 19:33842047-33842069 CTGTTTCAGGGGTAGCTGGAGGG - Intergenic
1165265085 19:34655181-34655203 CTAGTTCAGGTGAAGATGGAAGG + Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166505394 19:43368391-43368413 CTGGCTTAGGGGAAGGCAGAAGG - Intergenic
1166646113 19:44533019-44533041 CTGGCTTAGGAGAAGGTGGGTGG - Intergenic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167201362 19:48067717-48067739 CTGGAGTAGGGGAAGGGGGTGGG - Intronic
1167360965 19:49030150-49030172 GTGGCCCAGGGGTAGGTGGAGGG + Intronic
1167363450 19:49042542-49042564 GTGGCCCAGGGGTAGGTGGAGGG + Intergenic
1168277724 19:55286456-55286478 GGGGTTCAGGAGAAGGTGGAGGG + Intronic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
925313960 2:2907205-2907227 CTGGAAGAGGGGATGGAGGAAGG - Intergenic
925340273 2:3131158-3131180 CTAGAGCAGGGAAAGCTGGAGGG + Intergenic
925457293 2:4027030-4027052 CTGGCTGAGTGGAAGCTGGAGGG + Intergenic
926126680 2:10276648-10276670 CTGGCCCAGGGGTGGGTGGAGGG - Intergenic
927177672 2:20421963-20421985 CTGGGCCTGGGGATGGTGGAGGG - Intergenic
927241644 2:20924657-20924679 CAGGAGCAGGGTAGGGTGGAGGG + Intergenic
927528040 2:23766604-23766626 CTGCACCAGGGAAAGCTGGATGG + Intronic
927859367 2:26550908-26550930 ATGCATCAGGGGAGTGTGGAGGG - Intronic
928241162 2:29587872-29587894 CTGGTTCAGGGGAAAGAGGTGGG + Intronic
928245643 2:29624588-29624610 CTGGAGCAGGGGATGGGGGGAGG + Intronic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
929047479 2:37804131-37804153 TGGGGTCAGGGGAAGGAGGAAGG - Intergenic
930272258 2:49270553-49270575 CTGGATCAGGGGAATTTTGCTGG - Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931630755 2:64296340-64296362 CTGGTTCAGGGGGAGGTGCGGGG + Intergenic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932751324 2:74373498-74373520 CTGGTTCTGGGGAAGGGGGTTGG - Intronic
934497058 2:94812580-94812602 CTACAACAGGGGTAGGTGGAGGG + Intergenic
935656288 2:105426528-105426550 CTGGCTCAGGGAAGGGAGGAGGG - Intronic
935784139 2:106533625-106533647 AAGGAACAGGGGAGGGTGGAAGG + Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936056215 2:109264154-109264176 GTGGATCCTGGGGAGGTGGATGG - Intronic
936056276 2:109264368-109264390 GTGGATCCTGGGGAGGTGGACGG - Intronic
936056290 2:109264411-109264433 GTGGATCGTGGGGAGGTGGATGG - Intronic
936381902 2:111993841-111993863 CTGGTTCAAGGGCAGGTGGCAGG + Intronic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG + Intergenic
937463444 2:122109390-122109412 CTGGATCCTGGGAAGGTGAAGGG + Intergenic
937631113 2:124102111-124102133 CTGGTTCAGGGGGTGGTGGAGGG - Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938920178 2:135987671-135987693 CTGGAACATGAGAGGGTGGAAGG + Intergenic
938923883 2:136021107-136021129 CTGGGTCAAGAGAATGTGGATGG + Intergenic
938928617 2:136066635-136066657 ATGGATGAGGGTGAGGTGGATGG + Intergenic
939059335 2:137400849-137400871 CTGGAGCAGGGGAAGAAGGTAGG + Intronic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940210687 2:151253718-151253740 CTGGATCATGGAAAGGTGTCTGG - Intronic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
941023098 2:160430946-160430968 CTGGAGGAGGGAAAGGGGGATGG - Intronic
941423367 2:165312144-165312166 CTGGATGAGTGGGAGGTGGCAGG - Intronic
941616494 2:167726367-167726389 CTGGACAAGGGGCAGGTGGGCGG - Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942175974 2:173335075-173335097 CTGGAGCAGGCCAAGGTGGGAGG - Intergenic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
944317951 2:198303496-198303518 CTGGACCATGTGAAGCTGGAAGG - Intronic
944481389 2:200160996-200161018 CTGGATGGGGGGTCGGTGGAGGG + Intergenic
946325218 2:218981557-218981579 CTGGATTAGAGGACGGTTGACGG + Exonic
946390696 2:219415082-219415104 TGGGAGGAGGGGAAGGTGGAGGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947718390 2:232352939-232352961 CTGGATCAGGAGCTGGGGGAAGG - Intergenic
948021348 2:234736312-234736334 CTGGAGTAGGGGAAGGGGGCAGG - Intergenic
948658934 2:239494884-239494906 CGGGTTCAGGGCAAGGTGGGAGG - Intergenic
948673414 2:239583307-239583329 CAGGTCCAGGGGAAGGTGCAGGG - Exonic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1169282804 20:4281283-4281305 TTGGATCATGGGAGAGTGGAAGG + Intergenic
1170116160 20:12862413-12862435 CTGTAGCAGGCAAAGGTGGAAGG - Intergenic
1170146660 20:13182531-13182553 CTGGATCATGAGGAGGTTGAGGG - Intergenic
1171400304 20:24868858-24868880 GGGGAGCAGGGGAAGGTGGGAGG - Intergenic
1171406758 20:24916974-24916996 CAGGCTCAGGAGAAGCTGGAAGG - Intergenic
1171888353 20:30679361-30679383 CTACAACAGGGGTAGGTGGAGGG + Intergenic
1172144163 20:32744433-32744455 CTGGAGCAGGGAAATGTGGGGGG + Intergenic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172562696 20:35903670-35903692 CTGGATCACAGCAAGATGGATGG - Intronic
1172706045 20:36882746-36882768 CTGGATCCTGGGAAGCTCGATGG - Intronic
1173619800 20:44428368-44428390 CTGCATCAGGTGAGGGTGCAGGG - Exonic
1173976600 20:47191490-47191512 ATGGATTAGTGGATGGTGGATGG + Intergenic
1174548357 20:51343422-51343444 CTGGAGCAGGGTGAGGAGGAAGG + Intergenic
1174736349 20:52969383-52969405 ATGGACCAGGGCAGGGTGGATGG + Intergenic
1174898635 20:54475877-54475899 GTGGCTCTGGGGAGGGTGGAGGG - Exonic
1175172511 20:57090444-57090466 CTGGATTTGGGGAGGGCGGAAGG + Intergenic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1175830410 20:61962264-61962286 CCTGATAAGGGGAAGGCGGATGG + Intronic
1176035063 20:63032122-63032144 CTGGATCAGAGGAGGGTGAGAGG + Intergenic
1176057958 20:63158651-63158673 GTGGATGAGTGGATGGTGGATGG + Intergenic
1176852383 21:13931415-13931437 CTACAACAGGGGTAGGTGGAGGG + Intergenic
1177196913 21:17912748-17912770 CTGGATCAGGGGTGGGAGGCAGG + Intronic
1177332886 21:19684232-19684254 CTGGAGCCAGGGAAGCTGGATGG - Intergenic
1177572859 21:22909614-22909636 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1178627580 21:34231096-34231118 TTGCATCAGAGGAGGGTGGAGGG + Intergenic
1179126822 21:38598395-38598417 CTTGTTCAGGGCCAGGTGGATGG - Intronic
1179154531 21:38838537-38838559 CAGGATCCGGGGAAGTTGAAGGG + Intergenic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179791636 21:43759320-43759342 CTGGAGCCAGGGAAGGTGGACGG - Exonic
1180138475 21:45876430-45876452 CTGGAGCAGGGGAAGGTGAGCGG + Intronic
1180706968 22:17816125-17816147 GTGGATCCAGTGAAGGTGGAGGG - Intronic
1180865913 22:19119812-19119834 CTGGTACAGGGCAGGGTGGAAGG - Intronic
1180956688 22:19744430-19744452 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1181335263 22:22124295-22124317 GTGGAACAGGGGAAGGGGGTGGG + Intergenic
1181427820 22:22855722-22855744 CTGGGTCAGGGGAGTCTGGAGGG + Intronic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1182060661 22:27394849-27394871 CTGGATACTGGGTAGGTGGATGG + Intergenic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1182689716 22:32150559-32150581 CTGGATCATGTGCAGGTGGGCGG + Intronic
1182859875 22:33549996-33550018 CAGGGTCAGGGGATGGGGGAGGG + Intronic
1183066703 22:35368482-35368504 ATGGATGAGGAGAAGGTTGAGGG - Intergenic
1183098509 22:35569026-35569048 CTGCATGCGGGGAAGGTGGGAGG + Intergenic
1183680350 22:39325017-39325039 CTGGATTAGGAGAGGATGGAAGG + Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184259966 22:43309120-43309142 CTGGAGCTGGTGAAGGTGCAGGG - Intronic
1184570833 22:45323938-45323960 CTGGTGCAGGGGAAGGTGCGTGG + Intronic
1185020176 22:48369890-48369912 CTGCCTCTTGGGAAGGTGGAGGG + Intergenic
1185142133 22:49108434-49108456 CTGGATCTGGGGAGTGAGGATGG - Intergenic
1185376585 22:50485419-50485441 CTGGGTCAGGAGAAGGTGTCTGG - Exonic
1185422031 22:50740118-50740140 CTGGCACAGGGGACTGTGGAAGG - Intronic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950266675 3:11578413-11578435 CTGGACCATGGGAAGGCGGCTGG - Intronic
950321457 3:12058650-12058672 CTGGAACAGGGGGAGAGGGATGG + Intronic
950613571 3:14141357-14141379 CTGGATCAGGGTAGAGTGGGTGG + Intronic
952755699 3:36864631-36864653 CAGAATCAGGGGAGGGTGGAGGG - Intronic
953317442 3:41942034-41942056 GTGGTTGAGGTGAAGGTGGAGGG - Intronic
953390777 3:42532484-42532506 CTGGAGCAGGGGATGGTGGTGGG - Intronic
954041617 3:47892040-47892062 CCAGTTCAGGGGAAGGTGGCAGG - Intronic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
955163693 3:56490020-56490042 CAGGACCAGGGGAAGGTTGGAGG - Intergenic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956816130 3:72910054-72910076 CTGAATCAGGGGAAGGGTGAAGG + Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957558611 3:81792875-81792897 CTGGAACCCAGGAAGGTGGAGGG + Intergenic
957827938 3:85474219-85474241 CTGGCTCATGGGATTGTGGATGG + Intronic
957875028 3:86133437-86133459 TGGGATGAGGGGAAGGGGGAGGG + Intergenic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
960235863 3:115281296-115281318 TTGGAACAGGGAAAGGAGGATGG - Intergenic
960477265 3:118144971-118144993 CTGGAGCCAGGGAAGCTGGAAGG - Intergenic
961372584 3:126440630-126440652 CAGGAGCAGGGGCAGGGGGAGGG - Intronic
961403182 3:126661595-126661617 GTGGGTCAGGGGAGGGTGGCTGG - Intergenic
961460160 3:127045119-127045141 CTGGCTCAGGTGCAGGTGGAGGG + Intergenic
961542637 3:127610443-127610465 AGGCTTCAGGGGAAGGTGGATGG - Intronic
961810845 3:129520928-129520950 GTGGGGCTGGGGAAGGTGGATGG - Intergenic
962708487 3:138067054-138067076 CTGGATTTGGGGAGGCTGGAGGG + Intronic
963356803 3:144218144-144218166 CTGGAGCAGGGGAAGTTTGGTGG + Intergenic
963730168 3:148963519-148963541 CTGGATGAAAGAAAGGTGGAAGG - Intergenic
964892877 3:161557849-161557871 GTGGAGCAGGGGCAGGTGGGAGG - Intergenic
965698663 3:171437315-171437337 CTGGAACAGAGCAAAGTGGAAGG - Intronic
966351576 3:179037382-179037404 CTAGATGAGGGGAATGTGGGTGG - Intronic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
966574530 3:181484777-181484799 CAGGATGAGGGCAATGTGGATGG + Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967035739 3:185647223-185647245 GTGGAGCAGGGGAAGGAGGGGGG + Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967717711 3:192782331-192782353 TTGGACCCGGGGAAGGTGGGTGG + Intergenic
968236201 3:197031129-197031151 CTGGATCAGGGGAAGGAACATGG + Intergenic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968620052 4:1599957-1599979 CTGCATCAGGGGAAGGGAGAGGG - Intergenic
969116690 4:4874629-4874651 CTGGATCAGGGCTGGGTGAAAGG - Intergenic
969308370 4:6338408-6338430 CTGGCTCAGGCCAAGGTGGAGGG + Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969666819 4:8562603-8562625 CTAAATCAGGAGAAGATGGAAGG + Intronic
969853103 4:9977551-9977573 CAGGAGCAGGGGGAGGGGGAGGG - Intronic
972830034 4:42803791-42803813 CTGGAGCAGGAGAAAGTGGGGGG + Intergenic
972960321 4:44446861-44446883 TTGGGACAGGGGAGGGTGGAAGG - Intronic
973328974 4:48893180-48893202 CGGGGGCAGGGGAAGGTGGCTGG + Intronic
973554383 4:52067478-52067500 CTGGGTCAGGGGAAAGTGACAGG - Intronic
975582064 4:75915771-75915793 TTAGATCTGGGCAAGGTGGAGGG - Intronic
975735941 4:77381156-77381178 CTAGATCAGGTGATGGTGTATGG - Intronic
977853942 4:101865033-101865055 CTTGATCAGGGGCAGGAAGAAGG + Intronic
978008530 4:103650214-103650236 CTGGAGCTGGGTGAGGTGGATGG + Intronic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
979994804 4:127418034-127418056 CTGAATCTGGGGAATGTGGGAGG - Intergenic
982463738 4:155704495-155704517 CTGCATCAGGAGGAGGTAGAAGG + Intronic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
984594643 4:181653854-181653876 CTGGGTCGGGGGAAAGGGGAGGG - Intergenic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985552725 5:541619-541641 GAGGAGCAGGGGAAGGTGGAGGG - Intergenic
985624184 5:976468-976490 CAGGGTCTGGGGGAGGTGGATGG + Intergenic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986501130 5:8401032-8401054 CTTGAGCAGGTGAAGATGGATGG + Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
986627122 5:9732494-9732516 ATGGACAAGGGGAAGATGGAAGG + Intergenic
987419152 5:17698005-17698027 CTGGATCATGGGAATGTGAAAGG - Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988730616 5:33969438-33969460 CAGGATTAGAGGTAGGTGGATGG - Intronic
989543114 5:42641124-42641146 GTCTATCAGGGGAAGGAGGAAGG - Intronic
990320316 5:54623474-54623496 CTGAAACAGGGCAAGGTGGATGG + Intergenic
990611350 5:57460041-57460063 TGGGGTCAGGGGAAGGGGGAGGG - Intergenic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
992667418 5:79024715-79024737 AAGAATCAGGGTAAGGTGGAGGG + Intronic
992791602 5:80219147-80219169 CAAGATCAGGGGAAGGGGAAAGG + Intronic
994349239 5:98725504-98725526 CTGGATCAGGGGAGTGTACAGGG - Intergenic
994696633 5:103079873-103079895 CTGGATCCAGGGAGGCTGGATGG - Intergenic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995532556 5:113106093-113106115 AGTGAACAGGGGAAGGTGGATGG - Intronic
995544454 5:113216000-113216022 CTGGAACAGGGAAAGGAGAAGGG - Intronic
995555093 5:113319545-113319567 CTGGACCAAGAGAAGATGGAAGG + Intronic
995666173 5:114544822-114544844 CTGGAGCCAGGGAAGCTGGATGG + Intergenic
995746237 5:115406951-115406973 TTGGCTCAGGGGTAGATGGAAGG + Intergenic
996364519 5:122686537-122686559 CGGGGTCAGGGGAGGGGGGAGGG + Intergenic
997254510 5:132418060-132418082 CTGGATCATGGGTAGTTGGCAGG - Intronic
997854213 5:137358534-137358556 AAGGAAGAGGGGAAGGTGGAGGG + Intronic
997893427 5:137695066-137695088 TTGGAAGAGGGGAAGGGGGAAGG - Intronic
997975801 5:138440612-138440634 CTGGCTCTGAGGGAGGTGGAGGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
999182671 5:149681109-149681131 GTGGAGCAGGGGAGGGAGGAGGG - Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999734553 5:154503096-154503118 CTGGAACAGGTCAAGCTGGAAGG + Intergenic
1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG + Intergenic
1001185413 5:169567001-169567023 CAGGAATAGGTGAAGGTGGAAGG - Intergenic
1001193642 5:169652714-169652736 TTGGACCAGGGGAAGGAGGAAGG + Intronic
1001317094 5:170651326-170651348 CTGTATCAGGGGAAGGCAGGTGG + Intronic
1001540574 5:172534843-172534865 CTGGATCAGGGGTGGGCGAAAGG - Intergenic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1002576523 5:180177145-180177167 CTGGATGAGGGGCAGTGGGATGG + Intronic
1004458403 6:15813106-15813128 ATGGATGATGGGCAGGTGGACGG + Intergenic
1007395935 6:41577878-41577900 GGAGATCAGGGTAAGGTGGAAGG - Intronic
1007904770 6:45448518-45448540 CTAGCTCTGGGCAAGGTGGATGG + Intronic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1010032752 6:71288366-71288388 CTGGACCAGGGAGAGGGGGAGGG + Intergenic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1013268217 6:108521093-108521115 ATGGACCAGGGGCAGGGGGATGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013589172 6:111605842-111605864 CTGGGCCCGGAGAAGGTGGAGGG - Exonic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1015447021 6:133317944-133317966 ATGGATCAACGGAAGGAGGATGG - Intronic
1015675765 6:135746497-135746519 GTGGGTCGGGGGAAGGGGGAGGG + Intergenic
1015902381 6:138081388-138081410 CGGGGTCAGGGGAAGGGGGGAGG + Intergenic
1016547205 6:145237834-145237856 CTGGATCTGGGAAGGGAGGAAGG - Intergenic
1018422337 6:163650263-163650285 CTGGACCAGGGGACTTTGGAAGG + Intergenic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1019496938 7:1345182-1345204 CTGGATAGGGGCACGGTGGATGG + Intergenic
1021589724 7:22247970-22247992 CTGGATGAGGGAAAGAGGGAGGG + Intronic
1022539178 7:31120787-31120809 CTGGCTGAGAGGAAGGTGGCTGG + Intergenic
1022969927 7:35507576-35507598 CAGCATGAGGGGAAGTTGGAGGG - Intergenic
1022989198 7:35691463-35691485 ATGGGTCAGGAGTAGGTGGAGGG - Intronic
1024099489 7:46015712-46015734 CTGGAGCCAGGGAGGGTGGACGG + Intergenic
1026994570 7:74606977-74606999 TTGGAGCAGGGGAAGGGGGTGGG - Intergenic
1027564948 7:79780072-79780094 GTGGAGTAGGGGAAGGGGGAAGG - Intergenic
1029337769 7:99916929-99916951 ATGGAGCATGGGAAGGAGGATGG - Intronic
1029491057 7:100870362-100870384 CTGGCTCAGGGGCACCTGGAAGG - Exonic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1030349887 7:108472549-108472571 CTGGATCAGCTGCAGTTGGAAGG - Exonic
1031097954 7:117443508-117443530 TTGGATCAGGGGAGGGTGTGAGG + Intergenic
1031468574 7:122143706-122143728 CTGGCTGAGGGGGCGGTGGATGG - Intronic
1031857333 7:126938200-126938222 CTGGCCCATGGGAAGGGGGAAGG - Intronic
1032197890 7:129799730-129799752 CTGGATGGGGGGCAGGTGGTAGG + Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1033158219 7:138974287-138974309 CTGGATCTCGGTGAGGTGGAGGG + Intronic
1034176451 7:149103824-149103846 CTGCATCAGGGGCAGCTTGAAGG - Exonic
1034256220 7:149725973-149725995 CTGGATGAGGAGAAGCTGGTGGG - Exonic
1034376398 7:150648764-150648786 CTGAATGAGGGGAAGTTGAAGGG - Intergenic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1034577096 7:152009727-152009749 CTGGAACATGGGAAGGTCCAGGG - Intronic
1034930975 7:155163933-155163955 CTGGCTCTGGTGGAGGTGGAAGG - Intergenic
1035055264 7:156031074-156031096 CTGGCCCAGTGGAAGCTGGAAGG - Intergenic
1035553339 8:545563-545585 AAGGCTGAGGGGAAGGTGGAGGG + Intronic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1036699238 8:11000976-11000998 CTGAATCAGAGGAAGGGGGCAGG - Intronic
1037053684 8:14408677-14408699 CTAGATGAGGGGAAAGTGGCAGG - Intronic
1039630371 8:39106159-39106181 CTCCATCTGGGGCAGGTGGAGGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044782016 8:95752856-95752878 ATGGATAAGGGGAAGGTGTTGGG - Intergenic
1044949654 8:97423296-97423318 ATGGATCAGGGCAGGGAGGAGGG - Intergenic
1045541949 8:103094898-103094920 CCGGAGCAGGGGAAGAGGGATGG + Intergenic
1045998819 8:108395528-108395550 CTGGATCTGTGGAATGGGGATGG - Intronic
1046538242 8:115544389-115544411 CTGGATTGGAGGCAGGTGGAAGG + Intronic
1047196173 8:122723579-122723601 GGGGATTAGGGGAAGGTGGAAGG - Intergenic
1048447904 8:134505660-134505682 CTGGCTCTGGGGATGGAGGAAGG + Intronic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1049076531 8:140400755-140400777 CGGGAGCAGGGAAAGGAGGAAGG + Intronic
1049157625 8:141076466-141076488 CTGGGACAGGGGAAGGTAAATGG + Intergenic
1049324206 8:142013562-142013584 CTGGATCAGGAGACTGTGGGAGG + Intergenic
1049586211 8:143433529-143433551 GTGCATCCGAGGAAGGTGGAGGG + Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1049800549 8:144515650-144515672 CTGGACCAGGGGTACCTGGAAGG + Intronic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050475656 9:6038070-6038092 CTGAATCACGAGAATGTGGAGGG - Intergenic
1051003641 9:12315369-12315391 CTGGAACCAGGGAAGCTGGACGG - Intergenic
1051361164 9:16282934-16282956 GTGGATCTGGGCAGGGTGGAAGG - Intergenic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1052231536 9:26160317-26160339 TTTCATCAGGGGAAGATGGATGG + Intergenic
1052503731 9:29325966-29325988 CTGGATGAGAGGAAGGTTGGAGG - Intergenic
1053660091 9:40267890-40267912 CTACAACAGGGGTAGGTGGAGGG - Intronic
1054372224 9:64414194-64414216 CTACAACAGGGGTAGGTGGAGGG - Intergenic
1054524507 9:66108327-66108349 CTACAACAGGGGTAGGTGGAGGG + Intronic
1054679842 9:67903891-67903913 CTACAACAGGGGTAGGTGGAGGG - Intergenic
1055807585 9:80114169-80114191 AGGGATCAGCTGAAGGTGGAAGG + Intergenic
1055872650 9:80902085-80902107 GTGGGTCAGGGGAAGGAGGGAGG + Intergenic
1055908385 9:81319412-81319434 CTGCATCAGGGGATGGTGAGGGG - Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056007134 9:82284882-82284904 CTGCCTCGGGGGAAGGTGGGTGG - Intergenic
1057159923 9:92882396-92882418 CTGGAAGGTGGGAAGGTGGAGGG + Intergenic
1057339684 9:94188825-94188847 CTGGATCAAGGTGTGGTGGATGG - Intergenic
1057453077 9:95182879-95182901 CTGGGACAGGGGAAGGTGACTGG + Intronic
1057929678 9:99182924-99182946 CTGGATGATAGGAAGCTGGAAGG - Intergenic
1058850995 9:109012715-109012737 CAGGTTCAGGGGAAGGGGTAGGG + Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059404177 9:114089724-114089746 TGGGTTCAAGGGAAGGTGGAGGG - Intronic
1061245111 9:129397571-129397593 ATGGATAAGGGGATGGTTGAAGG + Intergenic
1061296944 9:129681992-129682014 CTGTACCGTGGGAAGGTGGAGGG - Intronic
1061397054 9:130349027-130349049 CTGGATCCTGGGGAAGTGGAGGG - Intronic
1061911816 9:133729036-133729058 ATGGATGAAGGGAAGGGGGATGG + Intronic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062615751 9:137395020-137395042 CAGGATCCGGGGGAGGTGGCGGG - Intronic
1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG + Intergenic
1203491355 Un_GL000224v1:108419-108441 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203503979 Un_KI270741v1:50289-50311 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203557959 Un_KI270744v1:17235-17257 CTACAACAGGGGTAGGTGGAGGG + Intergenic
1186355835 X:8788845-8788867 CAGGAGCTGGGGGAGGTGGAAGG - Intergenic
1186377578 X:9020971-9020993 CAGGAGCTGGGGGAGGTGGAAGG - Intergenic
1187273253 X:17797766-17797788 CTGGATGAGGGGCAGGCAGAGGG + Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1188306751 X:28568587-28568609 ATGAATCAGGGAAAGGTGGAAGG - Intergenic
1188702031 X:33277114-33277136 ATGGATTGGGGGAAGGTGGCAGG - Intronic
1189195202 X:39146914-39146936 CTGGAACAGTGGGAGGTAGAAGG + Intergenic
1189859927 X:45261773-45261795 GTTGATCAGGGGAAGGAGGTAGG + Intergenic
1190212430 X:48459198-48459220 ATGGGTCCTGGGAAGGTGGAAGG - Intronic
1190976101 X:55402504-55402526 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1192187078 X:68954814-68954836 GTGGATCTGGGGAGGGTGGATGG - Intergenic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1192951932 X:76026425-76026447 CTGGAGCTGGGGAGGCTGGACGG + Intergenic
1193337855 X:80312278-80312300 CGGGAACAGTGGGAGGTGGAGGG + Intergenic
1194445873 X:93986702-93986724 CTGGAGCAGGGGATGCTGGATGG + Intergenic
1194596709 X:95867923-95867945 CTGGAGCCAGGGAAGCTGGATGG + Intergenic
1195086283 X:101417470-101417492 CTGGAGCAGGGGAAGGCAAAGGG - Intergenic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1197512852 X:127392489-127392511 CTGGATCAGCTGAAGTTAGAAGG + Intergenic
1198665522 X:139018092-139018114 TTGGCTCAGTGGAAGGTGAAAGG + Intronic
1198815082 X:140580814-140580836 CTGGCTCAGGGGTAGCTGAAGGG - Intergenic
1198846513 X:140918130-140918152 CTGGAGCTGGGAAAGGGGGAAGG + Intergenic
1199486824 X:148357489-148357511 ATGGCTCAGGTGAAGGTGGTTGG - Intergenic
1199548471 X:149032689-149032711 CCGGATCAGGGGTAGATGCAAGG - Intergenic
1199550250 X:149053648-149053670 CTAGGACAGGGGGAGGTGGAAGG - Intergenic
1199800742 X:151248365-151248387 CTGGAGCAGAGGGAGGGGGAGGG + Intergenic
1200115170 X:153766805-153766827 GAGGACCAGAGGAAGGTGGAAGG - Intronic
1200847427 Y:7845315-7845337 TGGGATGAGGGGAAGGGGGAGGG + Intergenic
1201236322 Y:11915449-11915471 CTGAATCAGGGCAAAGAGGAAGG - Intergenic
1202092523 Y:21208840-21208862 CTGGAGCAAGGGAGGCTGGAGGG + Intergenic