ID: 937983521

View in Genome Browser
Species Human (GRCh38)
Location 2:127628396-127628418
Sequence GCTGCTCTCCACGATGCATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937983512_937983521 14 Left 937983512 2:127628359-127628381 CCTTCATCTCCAGGGAGGCCCAG 0: 1
1: 0
2: 1
3: 62
4: 355
Right 937983521 2:127628396-127628418 GCTGCTCTCCACGATGCATGAGG 0: 1
1: 0
2: 2
3: 10
4: 86
937983508_937983521 28 Left 937983508 2:127628345-127628367 CCTGGTCACGCTGTCCTTCATCT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 937983521 2:127628396-127628418 GCTGCTCTCCACGATGCATGAGG 0: 1
1: 0
2: 2
3: 10
4: 86
937983520_937983521 -5 Left 937983520 2:127628378-127628400 CCAGGGCGGGCAGAGGCTGCTGC 0: 1
1: 0
2: 8
3: 65
4: 683
Right 937983521 2:127628396-127628418 GCTGCTCTCCACGATGCATGAGG 0: 1
1: 0
2: 2
3: 10
4: 86
937983517_937983521 5 Left 937983517 2:127628368-127628390 CCAGGGAGGCCCAGGGCGGGCAG 0: 1
1: 1
2: 3
3: 81
4: 601
Right 937983521 2:127628396-127628418 GCTGCTCTCCACGATGCATGAGG 0: 1
1: 0
2: 2
3: 10
4: 86
937983519_937983521 -4 Left 937983519 2:127628377-127628399 CCCAGGGCGGGCAGAGGCTGCTG 0: 1
1: 0
2: 4
3: 52
4: 461
Right 937983521 2:127628396-127628418 GCTGCTCTCCACGATGCATGAGG 0: 1
1: 0
2: 2
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937983521 Original CRISPR GCTGCTCTCCACGATGCATG AGG Exonic
902638428 1:17750604-17750626 GCTGCTCTCCACGTGGCCTCGGG - Intergenic
902870612 1:19311783-19311805 TCAGCTCTACACGATGCATGGGG + Intronic
903021718 1:20399768-20399790 CCTGCTCTGCACAATGTATGAGG + Intergenic
905199475 1:36306502-36306524 GCTGCCCTCTACGGTGCTTGGGG + Intronic
909251496 1:73362589-73362611 GTTGCTCTCCATGATGCAGATGG + Intergenic
911733561 1:101313630-101313652 GCTGCTGTCCACCATACAGGCGG - Intergenic
913371900 1:118108631-118108653 GCCTCTCTCCACGATGTTTGAGG + Intronic
921670780 1:217921602-217921624 TCTGCTCTCCACCGTGCATTGGG - Intergenic
923022247 1:230174243-230174265 GCTGCTCCCCACGTGTCATGCGG + Intronic
1065186112 10:23172614-23172636 GCTGCTCCTCCCGATGCTTGGGG + Intergenic
1073950150 10:108798227-108798249 CCTGCTCTCCCCAATACATGTGG - Intergenic
1083760967 11:64817498-64817520 GCGGCTCTCCAGGATGACTGTGG + Intergenic
1083763998 11:64833501-64833523 CCTGCTAGCCACGATGCACGTGG + Intronic
1089678428 11:120105982-120106004 CCTGCTCTCCACCATGCATCAGG + Intergenic
1090652788 11:128822296-128822318 ACTGCTCTCCATGAAGAATGTGG - Intergenic
1091695738 12:2627028-2627050 GCTGCTCTCCTAGTTGCAGGAGG - Intronic
1101328258 12:103735809-103735831 GCTGCTCTCCACAGTGTAAGAGG - Intronic
1103722295 12:122981307-122981329 CCTCCTCTCCCCGATGCCTGTGG - Exonic
1113716436 13:112511782-112511804 GCTGCTCTCCACTATACACTAGG + Intronic
1113798024 13:113069994-113070016 ACCGCGCTCCACGTTGCATGGGG + Intronic
1116231984 14:42229305-42229327 GCTCCTCAGCACCATGCATGTGG + Intergenic
1119203930 14:72779911-72779933 CCTGCTCTCCTGGATGCCTGAGG - Intronic
1119847227 14:77839554-77839576 ACTGCTCTCCACCCTGCAGGTGG - Intronic
1122288502 14:100667013-100667035 GCCCCTCTCCAAGATGCCTGAGG - Intergenic
1123640330 15:22398211-22398233 GCTGCTCAACAGGCTGCATGGGG + Intergenic
1127825345 15:62697914-62697936 GCTGGTGTCCACCCTGCATGCGG - Intronic
1128349924 15:66881781-66881803 GCTGCTCTCCTGGAGGCCTGGGG + Intergenic
1137262043 16:46839112-46839134 GCTGCCTTCCTCCATGCATGCGG - Intergenic
1138943164 16:61814855-61814877 GCTGCTCTCCATGATCCAACTGG + Intronic
1139480869 16:67229974-67229996 GCTGCTCTGGACCATGCCTGAGG + Exonic
1143622253 17:8087444-8087466 GCTGCTCTTCAGGAGGCAAGAGG + Exonic
1147218685 17:38915458-38915480 GCTGCTCTCCTCGCTTCATGAGG + Intronic
1150076664 17:62198067-62198089 GCTGCTCACCACCACACATGAGG - Intergenic
1151749296 17:76027527-76027549 GCTGCGCTCCCCTAGGCATGTGG - Intergenic
1155479313 18:26268280-26268302 GCTGATCTCCAACATGTATGAGG - Intronic
1157577561 18:48753891-48753913 GCTGCTCCCCACGAAACCTGCGG - Intronic
1160731420 19:643229-643251 GCGGATCTCCAGGATGCCTGGGG - Exonic
925437913 2:3857182-3857204 GCTGCTCACCAAGATGTCTGGGG + Intergenic
925880980 2:8352494-8352516 GCTGCTGTGCACGTTGCATGTGG + Intergenic
931890629 2:66667484-66667506 GTTGCTCTAAACGAGGCATGTGG - Intergenic
935131753 2:100265805-100265827 GCTGTCCTCCAGGATGCAGGAGG - Intergenic
937983521 2:127628396-127628418 GCTGCTCTCCACGATGCATGAGG + Exonic
944121565 2:196246165-196246187 GCTGCTCTCCTAGATGAATGAGG + Intronic
946401866 2:219472475-219472497 TCTTCTCTCCACGTTGCATGGGG + Intronic
946870335 2:224078950-224078972 GCTGCTATCTTTGATGCATGGGG - Intergenic
948605681 2:239133267-239133289 GCTGCGCTGCAGGATGCGTGGGG - Intronic
1175188102 20:57193282-57193304 GCTGCTCCCCAAGAGACATGTGG + Intronic
1175806156 20:61830408-61830430 GCTGCCCTCCTGGATGCAGGGGG - Intronic
1181394218 22:22607477-22607499 ACTGCTCTCCACAATGCATGTGG - Intergenic
949226560 3:1701650-1701672 TCTGTTTTCCATGATGCATGAGG - Intergenic
953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG + Intronic
954145613 3:48632915-48632937 CCTGCCCTCCATGATGGATGTGG + Intronic
954446902 3:50551736-50551758 GCTGCTCTCCATGCCACATGTGG + Intergenic
954627982 3:52033116-52033138 GTTGGTCTCCACACTGCATGAGG - Intergenic
959505351 3:107151056-107151078 GCATTGCTCCACGATGCATGTGG - Intergenic
962240531 3:133747439-133747461 ACAGCTCTCCAGGATGCATGAGG - Intronic
973026833 4:45283807-45283829 CCTGCTCTCCATGTTGCAGGTGG - Intergenic
973309572 4:48694178-48694200 GCTGCTCTCCAGGTTTCAAGTGG + Intronic
977654482 4:99505273-99505295 GCTACTCTCCACTCTCCATGTGG - Intergenic
986691204 5:10315405-10315427 GCTTCTTTCCAGGATCCATGTGG + Intergenic
987179649 5:15354195-15354217 GCTGCTTTCCATAATGTATGCGG - Intergenic
990316648 5:54589275-54589297 GCTGCCCTCCATGATCCCTGTGG + Intergenic
991925167 5:71698264-71698286 GCTGCTTTCCAGGAAGCATGTGG - Intergenic
992133703 5:73721173-73721195 GCTGCTCTCCACCATGTATGAGG + Intronic
995431338 5:112081545-112081567 ACTGCTCACCACATTGCATGTGG + Intergenic
997613915 5:135233311-135233333 GCTGCTCTCCATGTGGCCTGAGG - Intronic
1001091986 5:168748418-168748440 GCTACTCTCCTCGTTGCCTGTGG + Exonic
1002320780 5:178374410-178374432 GCTGCTGTCCACGGTGTCTGTGG - Intronic
1003427499 6:6007374-6007396 CCCGCTCTCTACGATGCAGGGGG + Intronic
1013319021 6:108968482-108968504 GCTCCTCTTCACGAACCATGGGG + Intronic
1013635488 6:112025482-112025504 ACAGCTCTGCACCATGCATGGGG + Intergenic
1018681926 6:166271754-166271776 GCTGCTATCCTTGATGGATGGGG - Intergenic
1018841929 6:167523670-167523692 TCTGCTCTCCATGATCCTTGCGG - Intergenic
1020611053 7:10398565-10398587 GCTTATCTTCAAGATGCATGAGG - Intergenic
1022382840 7:29876051-29876073 GCTGCTTCCCAGGATGCATATGG + Intronic
1023939804 7:44762124-44762146 CCTGCTCTCCACCCTGCAAGGGG - Intronic
1024979657 7:55146645-55146667 GATGCTCTCCACGTTGCACAGGG - Exonic
1026649992 7:72208859-72208881 GCTGCTCTCCAGGAAGGCTGGGG + Intronic
1026988494 7:74569726-74569748 GCTGGGCCCCACGATGGATGGGG + Intronic
1030587259 7:111435883-111435905 GCTGCTATCCTTGATGAATGGGG - Intronic
1035060109 7:156062797-156062819 GCTGCTCTATACAATCCATGTGG - Intergenic
1037936710 8:22919865-22919887 GCTGGTCTCCACCAGGCTTGGGG + Intronic
1041031737 8:53743629-53743651 GCTGGTCTTCATGATGCATGTGG + Exonic
1042827608 8:72994234-72994256 CCTGCTCTACAGGATGCAAGAGG + Intergenic
1047820638 8:128516273-128516295 GGTCCCTTCCACGATGCATGGGG + Intergenic
1049129969 8:140829954-140829976 GGTGCTCTCCACGCTGGATATGG + Intronic
1049453745 8:142676550-142676572 CCTGATCCCCAAGATGCATGGGG + Intronic
1051462787 9:17341952-17341974 GCTGCTAACCAAGATGAATGTGG - Intronic
1052719459 9:32155756-32155778 GCTGCTTTCCACAGTGCCTGGGG + Intergenic
1055593166 9:77839132-77839154 GCTGTTCACCACGAGGCCTGGGG - Intronic
1057223133 9:93268427-93268449 GCTTCCCTCCACGAAGCAGGTGG - Intronic
1057842149 9:98495015-98495037 GCTGCTCTGCAGGAAGCATCTGG - Intronic
1059376789 9:113888319-113888341 GCTGCTCTCCCCATTTCATGGGG + Intronic
1061764505 9:132873237-132873259 GCTGCTACCCATGATGCATCAGG + Intronic
1203781493 EBV:103549-103571 GATGATCTCCACGATGCCTAGGG - Intergenic
1186618853 X:11215969-11215991 GCAGCTCTTCTCGATGGATGCGG + Intronic
1187364700 X:18656841-18656863 GCTGCTATAGACGATGCATAAGG - Intronic
1199408610 X:147493219-147493241 GCTACTTTCCACGAGACATGGGG - Intergenic
1202039156 Y:20664724-20664746 GCTGCTTTCCAGGTTGCAAGAGG - Intergenic