ID: 937984702

View in Genome Browser
Species Human (GRCh38)
Location 2:127633249-127633271
Sequence TCCGGGGCCCCGTCCTGAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937984702_937984710 -2 Left 937984702 2:127633249-127633271 CCCCCTCAGGACGGGGCCCCGGA 0: 1
1: 0
2: 2
3: 11
4: 126
Right 937984710 2:127633270-127633292 GAAGCAGCCCCCGCACCAGGTGG 0: 1
1: 0
2: 0
3: 19
4: 213
937984702_937984709 -5 Left 937984702 2:127633249-127633271 CCCCCTCAGGACGGGGCCCCGGA 0: 1
1: 0
2: 2
3: 11
4: 126
Right 937984709 2:127633267-127633289 CCGGAAGCAGCCCCCGCACCAGG 0: 1
1: 0
2: 2
3: 17
4: 489
937984702_937984712 4 Left 937984702 2:127633249-127633271 CCCCCTCAGGACGGGGCCCCGGA 0: 1
1: 0
2: 2
3: 11
4: 126
Right 937984712 2:127633276-127633298 GCCCCCGCACCAGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 22
4: 249
937984702_937984711 1 Left 937984702 2:127633249-127633271 CCCCCTCAGGACGGGGCCCCGGA 0: 1
1: 0
2: 2
3: 11
4: 126
Right 937984711 2:127633273-127633295 GCAGCCCCCGCACCAGGTGGAGG 0: 1
1: 0
2: 4
3: 27
4: 255
937984702_937984716 7 Left 937984702 2:127633249-127633271 CCCCCTCAGGACGGGGCCCCGGA 0: 1
1: 0
2: 2
3: 11
4: 126
Right 937984716 2:127633279-127633301 CCCGCACCAGGTGGAGGTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937984702 Original CRISPR TCCGGGGCCCCGTCCTGAGG GGG (reversed) Exonic
900115651 1:1026743-1026765 CCCGGGGTTCCATCCTGAGGTGG - Intronic
900121267 1:1049583-1049605 TCGTGGGCGCCGGCCTGAGGGGG + Exonic
900350719 1:2233258-2233280 TCCGGGATCCTGTTCTGAGGGGG + Intronic
900612025 1:3548300-3548322 TTCCAGGGCCCGTCCTGAGGAGG - Intronic
900630677 1:3633528-3633550 TCCGGGTCCCTGTCCTGAGCCGG - Intronic
901086516 1:6614650-6614672 TCGGGGGCCGCGTCCTCCGGGGG + Intronic
902629627 1:17696954-17696976 TGAGGGGCCCCGGGCTGAGGAGG + Exonic
903018567 1:20377796-20377818 TCCGGGAACCCGTCCTGAGCTGG - Intergenic
903597103 1:24503083-24503105 TCCCGGCTCCCGTCCTGCGGCGG + Exonic
905918074 1:41699633-41699655 CCCGGGGCCCCATCCTGCGTTGG - Intronic
906264608 1:44418442-44418464 TCCAGGGCTCCGTCCTTCGGCGG + Intronic
918393213 1:184088111-184088133 TCAGAGGCCTCTTCCTGAGGTGG - Intergenic
1065342776 10:24723039-24723061 TCCCCCGCCCCTTCCTGAGGCGG + Intronic
1067559493 10:47294968-47294990 TCCTGGGCCCAGTCCTCAGCAGG + Intergenic
1067778023 10:49176997-49177019 TCAGGGGCCCCTTCCAGAGGGGG + Intronic
1069835521 10:71305574-71305596 TCCAGGGCCCAGTTCTAAGGAGG - Intergenic
1076335800 10:129705815-129705837 TCCTGGGCCCCGTGCAGAAGGGG - Intronic
1077112415 11:867718-867740 CCCGGGGGCTCCTCCTGAGGCGG + Intergenic
1077220104 11:1411981-1412003 TGCGCCGCCCCGTCCTGCGGTGG + Intronic
1077220113 11:1412017-1412039 TGCGCCGCCCCGTCCTGCGGTGG + Intronic
1077220122 11:1412053-1412075 TGCGCCGCCCCGTCCTGCGGTGG + Intronic
1077220131 11:1412089-1412111 TGCGCCGCCCCGTCCTGCGGTGG + Intronic
1077220140 11:1412125-1412147 TGCGCCGCCCCGTCCTGCGGTGG + Intronic
1077220149 11:1412161-1412183 TGCGCCGCCCCGTCCTGCGGTGG + Intronic
1077220158 11:1412197-1412219 TGCGCCGCCCCGTCCTGCGGTGG + Intronic
1077220167 11:1412233-1412255 TGCGCCGCCCCGTCCTGCGGTGG + Intronic
1077220176 11:1412269-1412291 TGCGCCGCCCCGTCCTGCGGTGG + Intronic
1077220185 11:1412305-1412327 TGCGCCGCCCCGTCCTGCGGTGG + Intronic
1077220194 11:1412341-1412363 TGCGCCGCCCCGTCCTGCGGTGG + Intronic
1077220203 11:1412377-1412399 TGCGCCGCCCCGTCCTGCGGTGG + Intronic
1077220212 11:1412413-1412435 TGCGCTGCCCCGTCCTGCGGTGG + Intronic
1077220220 11:1412449-1412471 TGCGCCGCCCCGTCCTGTGGTGG + Intronic
1077233902 11:1470770-1470792 TCACAGGCCCCTTCCTGAGGAGG - Intronic
1077864346 11:6210617-6210639 TCTGGGGCCCCCTCCAGAAGGGG - Exonic
1083267028 11:61551517-61551539 TCCGGGTCCCTGTTCTGGGGAGG - Intronic
1085048717 11:73368423-73368445 TCCAGGGCCCCAGCCTGATGGGG + Exonic
1085465667 11:76721746-76721768 TCTGGGGACCCGTACTGTGGGGG + Intergenic
1089557035 11:119320554-119320576 TCCGGTGGCCCATCCTGGGGAGG + Intronic
1096677538 12:53233707-53233729 TCCAGGGTCCCGTCCCCAGGTGG + Intergenic
1103125916 12:118422254-118422276 TCCAGGGACCCGTTCTGTGGTGG - Intergenic
1103949487 12:124543193-124543215 GCCGCAGCCCCGTCCAGAGGGGG + Intronic
1108227471 13:48303984-48304006 GCCGCCGCCCCCTCCTGAGGAGG + Exonic
1113448332 13:110387570-110387592 TCGGGGGCCCCGAGCTGGGGAGG + Intronic
1113798980 13:113076844-113076866 GCCGGGGCCCCGTCCCGTGTGGG + Intronic
1115687290 14:35809152-35809174 TCCGGGGCCCCGGCCTGTGGCGG - Exonic
1115752893 14:36508306-36508328 TTGGGGGCCGCGTCCTCAGGGGG + Intronic
1117978646 14:61321502-61321524 TCCGCGGCCCGGCCCTGCGGTGG - Intronic
1118309607 14:64682671-64682693 GCCGGGGCCCAGCCCTGAGGAGG + Intergenic
1119435302 14:74594520-74594542 GACAGGGCCCCGGCCTGAGGAGG - Intronic
1122422338 14:101585334-101585356 TCAGGGGCCCAGTCCTGTGGTGG - Intergenic
1123683696 15:22782442-22782464 TGCTGGGCTCAGTCCTGAGGTGG - Intronic
1124406895 15:29401015-29401037 TCCGGGGCCCAGGCTTGAAGGGG - Intronic
1131215339 15:90530686-90530708 TCCAGGGCCCGGCCCTGGGGTGG + Intronic
1131258117 15:90874533-90874555 TTAGGGGCCATGTCCTGAGGGGG - Intronic
1132497997 16:272918-272940 TCGGGGGCCCCGGGCTGCGGAGG + Exonic
1133241369 16:4416307-4416329 GCCGGGGCCCTGGCCTGAAGGGG + Intronic
1133749539 16:8713712-8713734 TCCGGGACACCCTCCTGAGGAGG + Exonic
1139512795 16:67436938-67436960 TCCTGGGCTGCGTCCTGTGGTGG - Exonic
1140440593 16:74984846-74984868 CCCTAGGCCCCGTACTGAGGAGG - Intronic
1141516660 16:84549357-84549379 TCCGGAGCCCTGACCTGTGGTGG + Intronic
1141608817 16:85170107-85170129 CCTGGGGCCCCGTCCTGGTGGGG - Intergenic
1142056976 16:88004127-88004149 CCCAGGGACCCGTCCTGAGGGGG - Intronic
1142509789 17:386141-386163 TCCGGGGCCCAGTCCGAGGGCGG - Intronic
1143101878 17:4509046-4509068 ACCGGGGCCCATTCATGAGGTGG + Intronic
1151999595 17:77637168-77637190 TCAGAGGCCCCTTCCTGATGCGG - Intergenic
1152566780 17:81103809-81103831 TCCAGGGGCCCCTGCTGAGGGGG + Intronic
1152781443 17:82228908-82228930 CCCGGGAGCCCGTCCGGAGGCGG + Intronic
1152812225 17:82387343-82387365 CACGGGGCCCCTTCCTGGGGAGG + Intergenic
1153624153 18:7007263-7007285 CCAGGGGCGCAGTCCTGAGGGGG + Exonic
1154344817 18:13532880-13532902 TCAGGGGCCCTGTCCTGGGCAGG + Intronic
1160576197 18:79855307-79855329 TCTGGGGGCCCGTCCTGTGCAGG + Intergenic
1160846912 19:1170151-1170173 TCCTGGGCCCCGTGAGGAGGCGG - Intronic
1160967193 19:1751954-1751976 TCTGGGCCCCCAGCCTGAGGTGG - Intergenic
1161699939 19:5789030-5789052 TCCTGGGCCCAGCCCTCAGGAGG - Intronic
1163803926 19:19385089-19385111 CCCTGGCCCCCGTTCTGAGGAGG - Intergenic
1165096285 19:33411568-33411590 TCTGGGTCCCTGTCCTGAGAGGG - Intronic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
1167885021 19:52493219-52493241 CCCCGGGCCCAGTCCTGGGGAGG + Intronic
1168245987 19:55113436-55113458 TGCAGGGCCCCGTGCAGAGGGGG - Intronic
927174948 2:20399370-20399392 TCCAAGGCCCTGTCCTGAGAAGG + Intergenic
927957410 2:27217464-27217486 TCCGGCGCGCCGTCCTCACGTGG + Exonic
929240181 2:39646305-39646327 TCCTGGGCCTCTTCCTCAGGTGG + Intergenic
934538969 2:95159253-95159275 TCCAGAGCCTGGTCCTGAGGAGG - Exonic
937984702 2:127633249-127633271 TCCGGGGCCCCGTCCTGAGGGGG - Exonic
946024205 2:216662032-216662054 TCTGGGGCCCAGGGCTGAGGAGG - Intronic
1172841134 20:37903302-37903324 TCCGGGGCCCAGATGTGAGGCGG + Exonic
1172933162 20:38600517-38600539 TCCTGAGCCTCCTCCTGAGGAGG - Intergenic
1174562670 20:51442778-51442800 TCCGGGGCCACAGCCTGAGAGGG + Intronic
1174570276 20:51496455-51496477 TCTGGGGCAGCTTCCTGAGGAGG - Intronic
1175395850 20:58661043-58661065 TCCAGGGCCCCGTGCCCAGGCGG - Intronic
1176109941 20:63406589-63406611 TCGGAGGCACCGTGCTGAGGAGG + Exonic
1178362229 21:31958192-31958214 TCAGGAGCCACCTCCTGAGGAGG - Intronic
1179607352 21:42525370-42525392 GCCGGAGCCCCGCCCTGTGGGGG + Intronic
1180162426 21:46004185-46004207 TCCGGGGCTCAGCCCTGAGTTGG + Exonic
1181160508 22:20957273-20957295 TCGGGGGCACAGCCCTGAGGCGG + Intergenic
1184466227 22:44670010-44670032 TCCTGGTCCCTGTCCTGAGCTGG + Intronic
1185097490 22:48819363-48819385 TGCGCGGCCCCGTTCTGAGGCGG - Intronic
954036391 3:47853298-47853320 TCCGGGTCCCCCTGCTGGGGAGG - Exonic
954613702 3:51959086-51959108 GCCGGGATCCAGTCCTGAGGGGG + Exonic
958970318 3:100603775-100603797 TCAGAGGCTCCGTCCTGAGATGG + Intergenic
961053404 3:123766623-123766645 TCCGAGGACCCCTCCTAAGGCGG - Intronic
961535195 3:127566429-127566451 TCCTGGGCCCTGTCATCAGGAGG - Intergenic
961659829 3:128462850-128462872 GCCGGGGCCATGGCCTGAGGGGG - Exonic
962850853 3:139307274-139307296 TCCAGGGCCCAGCCCAGAGGAGG + Intronic
968319279 3:197750631-197750653 TCCGGGGCCGCGGCCGGAGGTGG - Intronic
968550830 4:1222702-1222724 CCCAGGGCCCCGTGCTGAGTGGG - Intronic
968901654 4:3435010-3435032 TGCGGGGACCCCTCCTGGGGTGG - Intronic
984995414 4:185425915-185425937 TCCGGGGGCCGGCCCTGAAGTGG + Exonic
985521262 5:374867-374889 TCCGGGGTCCTGGCCTGATGGGG + Intronic
985532661 5:443174-443196 TCCGGGGTCCCGGCCGGAAGTGG - Exonic
985644022 5:1076666-1076688 CCCAGGTCCCCGTCCTGTGGGGG + Intronic
985987987 5:3533420-3533442 TCTGGGGCCCCTCCCAGAGGCGG + Intergenic
986435591 5:7727155-7727177 GCCGTGGCCCGGTACTGAGGGGG - Exonic
997295451 5:132765864-132765886 TCTGGGGCCTCCTCCTGAGTAGG - Intronic
1000476414 5:161713428-161713450 TCCATGGCCCAGTCCAGAGGAGG + Intergenic
1002064959 5:176647387-176647409 GGCGGGGCCCGGTCCAGAGGCGG + Exonic
1005986810 6:30881007-30881029 TCCGGGGCCCCGGGCCCAGGAGG - Intronic
1006950809 6:37819873-37819895 GCCCGGGCCCCGCTCTGAGGAGG - Exonic
1007400587 6:41600235-41600257 TCCCGTGCCCACTCCTGAGGGGG - Exonic
1013231440 6:108165065-108165087 GCCGGGTCCACGCCCTGAGGAGG + Intronic
1018961428 6:168452015-168452037 TCTGGGGCTCCCTCCTGTGGTGG - Intronic
1019475352 7:1241609-1241631 CCCGGGGCGCCGCCCAGAGGGGG + Intergenic
1020119606 7:5495658-5495680 TCCGAGGCCGCATCCTGGGGCGG - Intronic
1022532188 7:31073990-31074012 TCCCAGGCCCCGGCCTGGGGTGG + Intronic
1034637128 7:152576335-152576357 ACCGGCCCCCAGTCCTGAGGTGG - Intergenic
1035034209 7:155884733-155884755 TCCGGGGAACCGGCCTGAAGGGG - Intergenic
1035287652 7:157816483-157816505 TCCAGTGCAGCGTCCTGAGGTGG - Intronic
1035580297 8:735819-735841 ACCGGGGCCCCGTCCTGCTGGGG - Intronic
1037967271 8:23144765-23144787 TCCAGGACCCCATGCTGAGGTGG + Intronic
1037986540 8:23294070-23294092 GCTGGGGCCCAGTCCTCAGGAGG + Intronic
1038328302 8:26588791-26588813 TCCGGTGCCCAGTCCTGGAGAGG + Intronic
1044442500 8:92238514-92238536 TCCGGGGCCCCGTTCTAAACCGG + Intergenic
1049460708 8:142726472-142726494 TCCTGTGCCCCTTCCTGACGAGG - Intergenic
1049605065 8:143525544-143525566 CCCTGGGGCCCATCCTGAGGGGG + Intronic
1056992349 9:91423729-91423751 TCCGGGGCCGCGGCGGGAGGCGG + Exonic
1058492738 9:105519794-105519816 TCCGGGGCCCCGGCCTGTGGCGG + Intronic
1059536036 9:115081785-115081807 CCCGGGGCCCTGGCCTGAAGAGG - Exonic
1062334351 9:136058418-136058440 TCCGGAGCCCCCTCCTGAGCAGG - Intronic
1062395261 9:136350246-136350268 TGGGGTGCCCCTTCCTGAGGTGG + Intronic
1062501814 9:136855016-136855038 CCCGGGCCCCCGTCCTGCTGCGG + Exonic