ID: 937986351

View in Genome Browser
Species Human (GRCh38)
Location 2:127639886-127639908
Sequence CAGGGGGTCTAGGGGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937986351_937986363 2 Left 937986351 2:127639886-127639908 CCCTGGATCCCCTAGACCCCCTG 0: 1
1: 0
2: 1
3: 28
4: 177
Right 937986363 2:127639911-127639933 CCTGCCCCCATCTCCCTGGGTGG 0: 1
1: 0
2: 3
3: 61
4: 481
937986351_937986361 -1 Left 937986351 2:127639886-127639908 CCCTGGATCCCCTAGACCCCCTG 0: 1
1: 0
2: 1
3: 28
4: 177
Right 937986361 2:127639908-127639930 GAACCTGCCCCCATCTCCCTGGG 0: 1
1: 0
2: 3
3: 77
4: 431
937986351_937986369 13 Left 937986351 2:127639886-127639908 CCCTGGATCCCCTAGACCCCCTG 0: 1
1: 0
2: 1
3: 28
4: 177
Right 937986369 2:127639922-127639944 CTCCCTGGGTGGTATAAGGCCGG 0: 1
1: 0
2: 0
3: 14
4: 141
937986351_937986370 14 Left 937986351 2:127639886-127639908 CCCTGGATCCCCTAGACCCCCTG 0: 1
1: 0
2: 1
3: 28
4: 177
Right 937986370 2:127639923-127639945 TCCCTGGGTGGTATAAGGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 113
937986351_937986360 -2 Left 937986351 2:127639886-127639908 CCCTGGATCCCCTAGACCCCCTG 0: 1
1: 0
2: 1
3: 28
4: 177
Right 937986360 2:127639907-127639929 TGAACCTGCCCCCATCTCCCTGG 0: 1
1: 0
2: 4
3: 31
4: 309
937986351_937986368 9 Left 937986351 2:127639886-127639908 CCCTGGATCCCCTAGACCCCCTG 0: 1
1: 0
2: 1
3: 28
4: 177
Right 937986368 2:127639918-127639940 CCATCTCCCTGGGTGGTATAAGG 0: 1
1: 0
2: 2
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937986351 Original CRISPR CAGGGGGTCTAGGGGATCCA GGG (reversed) Intronic
903269351 1:22178009-22178031 CAGGGGGTGCGGGGGAGCCATGG - Intergenic
903668991 1:25024514-25024536 CAGAGAGTCTTGGGGGTCCAGGG + Intergenic
905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG + Exonic
905169114 1:36099197-36099219 CAGGGGGTCCTGGGGGTCCCCGG + Exonic
905942299 1:41873831-41873853 CATGGGGTCTAGGGGAAATAAGG + Intronic
906326460 1:44849186-44849208 CAGGGGTTCTAAGGGCTCCATGG + Intergenic
906348770 1:45038994-45039016 CAGGCAGTCGATGGGATCCAGGG + Exonic
911838370 1:102650172-102650194 CAGGGGGTGGAGGGGATCTAGGG - Intergenic
912348306 1:108987114-108987136 CAGGAGGGCTAAGGGATCTATGG - Intronic
914784519 1:150816489-150816511 CAGGAAGTCAAGGGGATCTAGGG - Intronic
915535641 1:156533825-156533847 CAGGGGGTCTTGGTGATCAGGGG + Exonic
923506098 1:234608405-234608427 GAGGGGGTCTAGGGGAGAAAAGG - Intronic
924029236 1:239869624-239869646 AAGGAAGTCTTGGGGATCCATGG - Intronic
1063188504 10:3671225-3671247 CTGGGGGTCTGGGGGACTCAGGG + Intergenic
1064237538 10:13589663-13589685 CAGAGGGTCTACAGGACCCATGG + Intronic
1070768264 10:79068575-79068597 CAGGGGGGCTGGGGGCTGCAGGG + Intergenic
1071528384 10:86371655-86371677 CAGGGGGTCAAGGGGAATCCTGG - Intergenic
1074372135 10:112908679-112908701 CAGGAGGTCTAGGGGAAGCGGGG + Intergenic
1076909107 10:133378759-133378781 CAGTGGGTCTGGGGGTGCCACGG - Intergenic
1077334477 11:1997330-1997352 AAGGAGGTTTAGGGGATCGAGGG - Intergenic
1077592475 11:3503304-3503326 CAGGGGGTCTGGGGAATACAGGG - Intergenic
1083651627 11:64207841-64207863 GAGGGGGTCTAGGTGACCCAGGG + Intronic
1084248308 11:67876027-67876049 CAGGGGGTCTGGGGAATACGGGG - Intergenic
1084548870 11:69828897-69828919 CAGTGGGGCTGGGGGAGCCATGG - Intergenic
1084824513 11:71719454-71719476 CAGGGGGTCTGGGGAATACAGGG + Intergenic
1087044157 11:93830364-93830386 CAGGGTGGCCAGGGGATGCAGGG - Intronic
1089688245 11:120170251-120170273 CAGAGGGTCCAGGGGCTCCCGGG - Exonic
1089844306 11:121446420-121446442 AAAGGGGTCTGGGGGATCCTAGG + Intergenic
1202817460 11_KI270721v1_random:52512-52534 AAGGAGGTTTAGGGGATCGAGGG - Intergenic
1091754448 12:3042468-3042490 CATGGGCTCTAGGGGAACCTGGG + Intergenic
1093416629 12:18927967-18927989 TAGAGGGTTTAGGGGATCCTGGG - Intergenic
1094840132 12:34339367-34339389 CACGGGGTCCAGGGGACCCTGGG + Intergenic
1094843089 12:34350097-34350119 CAGGGGGTCCCGGGGACCCTAGG - Intergenic
1094870345 12:34596122-34596144 CAAGGGGCCGAGGGGATCCTGGG + Intergenic
1094871870 12:34603322-34603344 CATGGGTTCTAGGGAATCCTGGG + Intergenic
1095943428 12:47740512-47740534 CAGAGGCTCCAGGGGACCCAGGG + Intronic
1095981556 12:47977355-47977377 CAGCGGGGCCAGGGGAGCCAGGG + Exonic
1095981889 12:47978731-47978753 CAGGGGGACCAGGGGGTCCAGGG + Exonic
1095983700 12:47986407-47986429 CAGCGGGTCCAGGGGCTCCCTGG + Exonic
1096875090 12:54623266-54623288 GAGGGGGTCTAGGTGGTGCAGGG - Intergenic
1099108632 12:78528149-78528171 TGGGGGATCTAGGGGATCTATGG - Intergenic
1100824648 12:98463145-98463167 CAGGGGTTCTAGGGCAGCCTGGG + Intergenic
1102021628 12:109687338-109687360 CAGGGGGCCTAGGAAATCCGTGG + Intergenic
1103372121 12:120427458-120427480 CAGGGCATTTAGGGTATCCATGG + Intergenic
1103907466 12:124335016-124335038 CGGGGTGGCTGGGGGATCCAGGG - Intronic
1105766417 13:23564516-23564538 CAGGGGCTCTAGGGGAAGGAGGG + Intergenic
1108323748 13:49310110-49310132 CACGGGGAATAGGGGACCCACGG - Exonic
1108640900 13:52381412-52381434 CAGGTGTTTTAGGGGACCCATGG - Intronic
1111611761 13:90615281-90615303 TAGGGGGTTTGGAGGATCCATGG + Intergenic
1118893001 14:69924862-69924884 CAGGGGAGCTAGGGGAGCTAGGG + Intronic
1119723062 14:76904475-76904497 GAGTGGGTCTAGGGCAGCCACGG + Intergenic
1121586063 14:95063960-95063982 CAGGGAGTATAGGAGATGCAGGG - Intergenic
1121667753 14:95685958-95685980 CAGGGGGTCGTGGGGAGCAAAGG + Intergenic
1121818989 14:96950901-96950923 AAGGGGGTCTTGGGGCCCCATGG - Intergenic
1122262468 14:100531191-100531213 CAGGGGGTCACTGGGATCCCTGG + Intergenic
1122540124 14:102493427-102493449 CAGGGGATGCAGGGGCTCCAGGG - Intronic
1127520788 15:59741313-59741335 CTGGGGCTCTAGGTTATCCAAGG - Intergenic
1129796919 15:78384838-78384860 CCTGGGGTCTGGGCGATCCATGG - Intergenic
1131058334 15:89389674-89389696 CAGGGGGGCAAGGGGGCCCAAGG + Intergenic
1131985211 15:98036332-98036354 CAGGGGGTCTAGGAAGTCCAAGG + Intergenic
1132956455 16:2596862-2596884 CAGAGGGGCCAGGGGAGCCATGG + Intronic
1133301883 16:4787634-4787656 CAGGGGGTCCATGGGGGCCAAGG + Exonic
1133685202 16:8159868-8159890 CAGGGGGTCTGTGTGGTCCATGG + Intergenic
1135328433 16:21542639-21542661 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1136267641 16:29130695-29130717 CCGGGGGTGGAGGGAATCCAGGG - Intergenic
1136338780 16:29628612-29628634 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1136382334 16:29901360-29901382 CAGGGGGTCCTGGGGATCCCGGG + Exonic
1136920429 16:34266502-34266524 CAAGGGCTCCAGGGAATCCAGGG - Intergenic
1138081427 16:54094604-54094626 CAGGTGGACTTGGGAATCCAGGG + Intronic
1138549004 16:57736897-57736919 CAAGTGGTCTTGGTGATCCAGGG + Intronic
1139655632 16:68385574-68385596 CAGGGAGATTTGGGGATCCAAGG - Intronic
1139661508 16:68424087-68424109 CAGGGGGCCTAGGTGGTCCTAGG + Intronic
1142041463 16:87897177-87897199 CACCAGGTCCAGGGGATCCAGGG - Intronic
1142070947 16:88091039-88091061 CCGGGGGTGGAGGGAATCCAGGG - Intronic
1142110626 16:88329216-88329238 CAGGTGGTGAAGGGGCTCCAGGG + Intergenic
1142161386 16:88559377-88559399 CAGGGGGCCCAGGGGAGTCAAGG - Intergenic
1142285750 16:89170872-89170894 CAGGGGGCCTCGGGGAACAAGGG + Intergenic
1142298630 16:89243236-89243258 CAGGGGGCCTCGGGGAACAAGGG + Intergenic
1142583045 17:953465-953487 CAGGGGGTGTGGGGCATCCGAGG - Intronic
1142984988 17:3690234-3690256 CAGAGGCTCCAGGGGACCCAAGG - Intronic
1144191054 17:12846309-12846331 CAGGGGGCCTGGGAGATCCAGGG - Intronic
1144626123 17:16845273-16845295 CATAGGGTCTCGGGGAGCCAAGG - Intergenic
1144635765 17:16907997-16908019 AAGGAGGTATAGGGGTTCCATGG - Intergenic
1144651328 17:17009083-17009105 CAGGAGGTCTAGGGGGGCCTTGG - Intergenic
1146659168 17:34653146-34653168 CAGGAGGTCTGGGGGATAAAAGG - Intergenic
1147582044 17:41632385-41632407 CAGGGGGGCCAGGGGAGCCAGGG - Intergenic
1148794085 17:50188920-50188942 CAGGGGGTCCAGCCAATCCAGGG + Exonic
1153153763 18:2126102-2126124 CAGAGGGTCTAGGGGAAGCAGGG - Intergenic
1153911343 18:9708589-9708611 CAGGGGGACCCGGGGAACCAGGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156537627 18:37879319-37879341 CAGTGGGTCTAGTGGGTCCCTGG + Intergenic
1160793431 19:933296-933318 CAGGGGGTCTCAGGGACCCCAGG + Intronic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1161992134 19:7690131-7690153 GAGGGGGCCTCTGGGATCCAGGG - Intronic
1162562772 19:11427017-11427039 CCGGTGGTCTAGGTGCTCCAGGG + Exonic
1162889146 19:13719715-13719737 CAGGGTATTTAGGGTATCCAGGG + Intergenic
1166295070 19:41884885-41884907 CAGTGGGTCTAAAGGATCCAGGG - Intronic
1167385967 19:49163845-49163867 CAGGGGAACTAGGGGATTCAAGG + Intronic
1167427486 19:49436942-49436964 CAGGGGGGCGAAGGGAGCCAGGG - Intronic
1168177713 19:54636444-54636466 CAGGGGGTCAGGAGGATTCAAGG + Intronic
1168334049 19:55586831-55586853 CAGGGGAGATAGGGAATCCATGG - Intergenic
925062704 2:905355-905377 GAGGGGGTCTGGGGCATCCCTGG - Intergenic
925306152 2:2849321-2849343 GAGGGGGTCTAGGGGAGGCCAGG - Intergenic
925467842 2:4125618-4125640 CAGCAGCTCTAGGGGAACCAAGG - Intergenic
925616459 2:5748625-5748647 CAGGGAGACTAGGGGCTGCAGGG - Intergenic
926082841 2:10002888-10002910 CAGGGGGTGAAGGAGACCCATGG - Intergenic
927089198 2:19697755-19697777 CAGTGGGACTTGGGGATCCCGGG - Intergenic
928118344 2:28564029-28564051 CAGGGGGTCAAGGTGAGCCTGGG + Intronic
929881643 2:45842031-45842053 CAGGGGGACTTGGTGATCCAGGG + Intronic
933759486 2:85663999-85664021 CAGAGAGTCCAGGGGATGCAGGG + Intronic
935763275 2:106341476-106341498 GAGGTGGTCTAGGAGTTCCAGGG - Intergenic
937040208 2:118814884-118814906 CAGAGGGTCTGGGGGGTCTAGGG + Intergenic
937986351 2:127639886-127639908 CAGGGGGTCTAGGGGATCCAGGG - Intronic
939562676 2:143751184-143751206 CAGAAGGTCTGGGGCATCCAGGG + Intronic
942216147 2:173720730-173720752 CAGAGACTCTAGGGGATCCATGG + Intergenic
943523473 2:188985724-188985746 CAGGGGGGCCAGGAGAACCAGGG - Exonic
946165663 2:217862402-217862424 CAGGGGGTACAGGGGATACTGGG - Intronic
948675003 2:239591965-239591987 CAGGGGGTTTAGGGGCTTGAGGG + Intergenic
1171040377 20:21757186-21757208 CACGGGAGCCAGGGGATCCAGGG - Intergenic
1175897525 20:62345997-62346019 CAGGGGGTGGAGGGGTTCCCCGG - Intronic
1175953402 20:62595889-62595911 CAGGCGGCCTCGGGGATCCTGGG - Intergenic
1176020157 20:62958653-62958675 CAGAGGTTCTAGGGGAGCCATGG - Intronic
1177902395 21:26933005-26933027 CTGGGGATCTTGGGGATCCTGGG - Exonic
1180085267 21:45505386-45505408 CAGGGGGCCCAGGGGGCCCAGGG - Exonic
1181788472 22:25244444-25244466 CAGAGGGTGAAGGGGAGCCATGG - Intergenic
1181820153 22:25469142-25469164 CAGAGGGTGAAGGGGAGCCATGG - Intergenic
1182164113 22:28155040-28155062 CAGAGGGTCGGGGGAATCCAGGG - Intronic
1184836173 22:47022444-47022466 CAGGGAGTCTGGGGAAGCCACGG + Intronic
1184886179 22:47345625-47345647 CAGGGGCTCCAGGGGTTCCTTGG + Intergenic
950441796 3:13014872-13014894 CAGTGGGTCAAGGGGCTCCTGGG + Intronic
950658647 3:14452922-14452944 CAGGGGGTCTGGAGGAGCCTAGG - Intronic
951415915 3:22420918-22420940 CAAGGGCACTAGGGGATCCAGGG + Intergenic
952649476 3:35707802-35707824 GCGGGGGGCTATGGGATCCAGGG + Intronic
954134297 3:48575072-48575094 CAGGGGGTCCGGGGGGCCCAGGG + Exonic
954134301 3:48575081-48575103 CGGGGGGCCCAGGGGTTCCAGGG + Exonic
955575969 3:60363749-60363771 CAGGGGGGCCAGGGGGGCCAGGG - Intronic
960034939 3:113092938-113092960 CAGGGTGTGTAGGGGAGTCAAGG - Intergenic
961058657 3:123810269-123810291 CAGGGAGACTATGGGAACCACGG - Intronic
961236610 3:125373580-125373602 CAGAAGGTCTAGGGGAACCTAGG - Intronic
961670580 3:128525859-128525881 CAGAGGGTCTCTGGGATCCTAGG + Intergenic
964041629 3:152268621-152268643 CGGGAGGCCGAGGGGATCCACGG + Exonic
968084979 3:195870166-195870188 CAGGAGGTCGGGGGGGTCCATGG + Exonic
968903310 4:3440951-3440973 GAGGGGTTTTAGGGGATACAGGG + Intergenic
969602211 4:8183050-8183072 CTGGGGGTGAGGGGGATCCATGG + Intronic
976226803 4:82800539-82800561 CAGTGGGCACAGGGGATCCAAGG + Intergenic
979275444 4:118810138-118810160 CAGAGGGTATAGGGGAGCCAGGG + Intronic
981023441 4:140052439-140052461 CACGGGGTCTAGGTGATCCATGG - Intronic
983979850 4:173982300-173982322 CAAGGGGGTTAGGGGAGCCAAGG + Intergenic
984145110 4:176050876-176050898 GAGGGGGACTAGGGGAGTCAGGG - Intergenic
985480442 5:107277-107299 CATGGGGTCTCTGGGGTCCAGGG - Intergenic
989307644 5:39975772-39975794 CAGTGGGTCCAGTGGATCCCTGG - Intergenic
990118110 5:52414238-52414260 CAGTGGGTCAAGGGAATCCACGG - Intergenic
990662699 5:58035213-58035235 CAGGGGGTTTAGAGGAATCAGGG + Intergenic
997368426 5:133340395-133340417 CAGGGAGTCCACAGGATCCAGGG + Intronic
998097080 5:139402085-139402107 AAGGGAGTCTAGGAGACCCAAGG - Intronic
1001775923 5:174329045-174329067 AAGGAGGTCCAGGGGATCCCTGG + Intergenic
1002076490 5:176711748-176711770 CAGGGGATCTGGGGGACCAAGGG + Intergenic
1002299085 5:178247533-178247555 CAGGGCCTCCAGGGAATCCAGGG - Exonic
1002349709 5:178575575-178575597 TAGGTGGTCTAGGTGAGCCATGG - Intronic
1002712647 5:181204544-181204566 CAGGGGGTCCCGGGGACCCACGG + Intronic
1004618814 6:17315447-17315469 CAGGGGGTGGAAGGGATCAAAGG + Intergenic
1005869807 6:29966339-29966361 CAGGAGGTCTTGGGGAGGCAAGG - Intergenic
1006893957 6:37454219-37454241 CAGGGGGTCTAGTGGAATGAGGG - Intronic
1016419771 6:143871892-143871914 CAGTGGGTCCAGTGGATCCCTGG - Intronic
1019154306 6:170029007-170029029 CAGAGGGTCTGAGGGATCCTGGG - Intergenic
1020513587 7:9089883-9089905 CTGGAGCTCTGGGGGATCCAAGG - Intergenic
1023718944 7:43073177-43073199 AATGAGGTCTAGGGAATCCAAGG - Intergenic
1026786627 7:73305614-73305636 CAGGGGGGTGAGGGGATGCAGGG + Intronic
1026948017 7:74328429-74328451 CAGGGGGTCCAGGGGATGAGAGG + Intronic
1034936778 7:155204953-155204975 CAGGGGGTCTCGGGGATGTCAGG - Intergenic
1035476876 7:159149975-159149997 CCGAGGGTGTGGGGGATCCAGGG + Intergenic
1035700242 8:1632900-1632922 CGGGAGGTCGAGGGCATCCATGG - Exonic
1036140336 8:6201679-6201701 CACGGAGTCTTGGGAATCCAAGG - Intergenic
1037889263 8:22614896-22614918 CTGGGGGTCGAGGCCATCCAGGG - Exonic
1039399077 8:37253321-37253343 GAGAGGGTCCAGGGGCTCCATGG + Intergenic
1040530689 8:48264166-48264188 CAGGGGGACTAGGAAAGCCAAGG - Intergenic
1040560677 8:48520934-48520956 TAGGTGGCCCAGGGGATCCATGG - Intergenic
1041483462 8:58348685-58348707 AAAGGGGTCTAGGTGAGCCATGG + Intergenic
1043364203 8:79513021-79513043 CAGGGGTTCTACGGCATCCAGGG - Intergenic
1047666919 8:127101586-127101608 CAGGGGGTCTAAAAGACCCAGGG + Intergenic
1048011255 8:130458052-130458074 TAGAGGCTCTAAGGGATCCATGG - Intergenic
1048186277 8:132244073-132244095 CAGGGGGTGTAGGAGGACCAGGG - Intronic
1048855603 8:138684442-138684464 CAGGGAGTCCAGGTGATCCACGG + Exonic
1049497335 8:142942422-142942444 CAGCTGGTCGAGGGGAGCCATGG - Intergenic
1049862538 8:144909891-144909913 CATGGGGTCTCTGGGAGCCACGG + Intergenic
1051966298 9:22833377-22833399 CAGTGGGTCTAGTGGGTCCCTGG + Intergenic
1052821507 9:33141149-33141171 CAGGTGGTATAGGGCATGCAGGG + Intronic
1053390400 9:37731042-37731064 CAGGAGGTCCAGGGGGTCCTTGG - Exonic
1058710857 9:107677886-107677908 CAAGGGGTCTGGGGTATCCCTGG + Intergenic
1059340173 9:113593674-113593696 CAGGGGGTCTAGGGAAAAGAGGG + Intronic
1059436895 9:114282498-114282520 CAGGGGGTCCAGGGTCTCCAGGG - Exonic
1060256382 9:122034728-122034750 CAGGGTTTCTAGCTGATCCAGGG + Intronic
1060827218 9:126694079-126694101 CATGGGGACTAGGGGACCCAGGG + Intronic
1062107585 9:134764212-134764234 TAGGGGGTCTAGGGGCAACATGG + Intronic
1062114866 9:134802929-134802951 CGGGGGGTCCAGGGGGCCCAGGG - Exonic
1185596885 X:1312664-1312686 CAGGTGGTCTAGGGCCTACAGGG + Intergenic
1186477684 X:9871098-9871120 CTGGGGGTCCAGGGATTCCAAGG - Intronic
1188310634 X:28612473-28612495 CAAGGAGTCTAGGGGAACCAAGG - Intronic
1190491045 X:50983112-50983134 AATGAGGTCTAGGGAATCCACGG + Intergenic
1192428479 X:71097023-71097045 AAGGGAGGCTAGGGGGTCCAGGG - Intronic
1193649056 X:84108648-84108670 CTGGAGGCCTAGGGGATTCAAGG - Intronic
1194403615 X:93467818-93467840 CAGGGGTTCTCAGGGATCCAAGG - Intergenic
1199551204 X:149063529-149063551 CAGGGGATATAGAGGATCCAGGG + Intergenic
1202092917 Y:21212919-21212941 AATGAGGTCTAGGGTATCCAAGG + Intergenic
1202259086 Y:22950761-22950783 CAGTGGGACTTGGGGATACAAGG - Intergenic
1202412072 Y:24584505-24584527 CAGTGGGACTTGGGGATACAAGG - Intergenic
1202458708 Y:25085563-25085585 CAGTGGGACTTGGGGATACAAGG + Intergenic