ID: 937986970

View in Genome Browser
Species Human (GRCh38)
Location 2:127642306-127642328
Sequence CGCTGCCGCCTCGGCTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937986970_937986977 30 Left 937986970 2:127642306-127642328 CCTGCAGAGCCGAGGCGGCAGCG 0: 1
1: 0
2: 3
3: 26
4: 235
Right 937986977 2:127642359-127642381 CCTGTGCCCCAGACAGGCCCTGG 0: 1
1: 0
2: 7
3: 266
4: 852
937986970_937986972 -8 Left 937986970 2:127642306-127642328 CCTGCAGAGCCGAGGCGGCAGCG 0: 1
1: 0
2: 3
3: 26
4: 235
Right 937986972 2:127642321-127642343 CGGCAGCGCCTTCTGATCTCTGG 0: 1
1: 0
2: 1
3: 3
4: 69
937986970_937986973 -7 Left 937986970 2:127642306-127642328 CCTGCAGAGCCGAGGCGGCAGCG 0: 1
1: 0
2: 3
3: 26
4: 235
Right 937986973 2:127642322-127642344 GGCAGCGCCTTCTGATCTCTGGG 0: 1
1: 0
2: 1
3: 8
4: 121
937986970_937986975 24 Left 937986970 2:127642306-127642328 CCTGCAGAGCCGAGGCGGCAGCG 0: 1
1: 0
2: 3
3: 26
4: 235
Right 937986975 2:127642353-127642375 AGACTTCCTGTGCCCCAGACAGG 0: 1
1: 0
2: 3
3: 16
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937986970 Original CRISPR CGCTGCCGCCTCGGCTCTGC AGG (reversed) Intronic
900003569 1:29347-29369 CGCCGCCGCTTCCGCTCTGCCGG + Intergenic
900023289 1:199863-199885 CGCCGCCGCTTCCGCTCTGCCGG + Intergenic
900193579 1:1362138-1362160 CCCTGCCTCCTCGGGGCTGCAGG - Intergenic
900484955 1:2918169-2918191 GCCTGCCGGCTCGGCTCTCCGGG - Intergenic
900616346 1:3567334-3567356 CCCTGCCTCCTCGCCTCTCCTGG + Intronic
900687576 1:3958456-3958478 CGATGCAGCCTGGGGTCTGCAGG + Intergenic
902218450 1:14949637-14949659 CGCAGCCCCCTGGGGTCTGCCGG - Intronic
904940162 1:34160119-34160141 AGCTGCCTGCTGGGCTCTGCCGG + Intronic
904941010 1:34164882-34164904 CGCTGGCTCCTCGGCGCGGCTGG + Intronic
908006974 1:59737440-59737462 CTCTGCCGCTTTGGATCTGCAGG - Intronic
909144345 1:71910771-71910793 CACTGCAGCCTCGGCTTCGCAGG + Intronic
909584030 1:77269648-77269670 CTCTGCCTCCTCTGGTCTGCTGG + Intergenic
912315093 1:108661119-108661141 CGCTACCGCCGCGGCTACGCCGG + Intronic
912582313 1:110731641-110731663 CTCTGCAGACTCGGATCTGCAGG - Intergenic
912670061 1:111617208-111617230 ACCTGCCGCCTCTGCTCTACAGG + Intronic
913703545 1:121396908-121396930 CCCCGCCGCCACGGCTCTGAGGG + Intergenic
913961947 1:143346399-143346421 GGCTGCTGCCTCGGTTGTGCCGG - Intergenic
913979896 1:143498619-143498641 CCCCGCCGCCACGGCTCTGAGGG + Intergenic
914056302 1:144171973-144171995 GGCTGCTGCCTCGGTTGTGCCGG - Intergenic
914074245 1:144324103-144324125 CCCCGCCGCCACGGCTCTGAGGG + Intergenic
914104931 1:144642343-144642365 CCCCGCCGCCACGGCTCTGAGGG - Intergenic
914122844 1:144794389-144794411 GGCTGCTGCCTCGGTTGTGCCGG + Intergenic
917906724 1:179592242-179592264 CAATGCCGCCTCCGCCCTGCAGG - Intronic
918174385 1:182030033-182030055 CGCTGCCTGCTCCGCTCTCCAGG - Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922116458 1:222618320-222618342 CGGCGCCGCCTGGGCTGTGCGGG + Intronic
923782973 1:237042349-237042371 CGCCTCCTCCTCCGCTCTGCAGG + Exonic
924778382 1:247126735-247126757 CGCTGCCCGCCCAGCTCTGCCGG - Intronic
924783276 1:247171685-247171707 CGCTGCCCGCCCAGCTCTGCCGG + Intronic
1062760231 10:11983-12005 CGCTGCCCACCCGGCGCTGCAGG + Intergenic
1064443167 10:15371233-15371255 CGCCGCCGCCGCGGCTCTTCGGG - Intergenic
1065023097 10:21516908-21516930 CGCCGCCGCCTTGGCTTTGTAGG + Exonic
1065827538 10:29585605-29585627 TGCTGCTGGCTCAGCTCTGCTGG - Intronic
1066473732 10:35724471-35724493 CACTGCAGCCTCGACTTTGCGGG - Intergenic
1067416355 10:46106240-46106262 CCCCGCCGCCTCCGCTCTCCTGG - Intergenic
1069019171 10:63466092-63466114 CGCTGCCGCCTCCGCAGGGCCGG - Intergenic
1070782692 10:79146753-79146775 CGCTTCCGCCCCGACTCTGCTGG + Intronic
1071695380 10:87863911-87863933 CGCCGCCGCCGCGCCTCAGCCGG - Exonic
1073461709 10:103669210-103669232 CGATGCTCCCTCTGCTCTGCTGG - Intronic
1074370706 10:112898835-112898857 CCCTGCTGCCTCGACTCTGGAGG + Intergenic
1074866417 10:117546667-117546689 CACCGCCGCCTCGGCTGTCCAGG - Intronic
1075266768 10:121007264-121007286 CTCTGCCACCCTGGCTCTGCAGG - Intergenic
1076035522 10:127196193-127196215 CGCTGCCGGCCCGGCCCTGCTGG + Intronic
1076726432 10:132416269-132416291 CCGTGCACCCTCGGCTCTGCAGG + Intronic
1078334093 11:10450619-10450641 CGCCGCCTCCTGGGCTCCGCGGG - Intronic
1078507606 11:11964481-11964503 GGCTGCCGCCGCTGCACTGCTGG - Exonic
1081779943 11:45703245-45703267 CGCTGCCGCCCCTGCTTTCCTGG - Intergenic
1083596257 11:63919425-63919447 CCCTGCCGCCCCGGGGCTGCGGG + Intergenic
1084064437 11:66695329-66695351 CACTGCAGCCTCGACTCTCCAGG + Intronic
1084146674 11:67268650-67268672 GGGCGCCGCCTTGGCTCTGCAGG + Intronic
1085436737 11:76511053-76511075 CACGGCGGCATCGGCTCTGCTGG - Intronic
1089323943 11:117644569-117644591 TGTGGCCGCCTCGCCTCTGCTGG - Intronic
1089622355 11:119729125-119729147 CCCAGCCGCCGCCGCTCTGCCGG + Intergenic
1090003988 11:122984315-122984337 CGCAGCCGCCCCGCCTCTGCCGG + Intergenic
1090400047 11:126443232-126443254 TGCAGCCGGCTCTGCTCTGCTGG - Intronic
1091286737 11:134412225-134412247 CGGTGCCGCCGCGGCTCTGCCGG + Intergenic
1091344839 11:134845661-134845683 CGCTCCCCCCACGGCTCTCCAGG + Intergenic
1091376988 12:31401-31423 CGCCGCCGCTTCCGCTCTGCCGG + Intergenic
1092218983 12:6700371-6700393 CCATCCCGCCTCGGCTCGGCGGG - Exonic
1094420314 12:30264034-30264056 CTCTGCCTCCGTGGCTCTGCAGG - Intergenic
1097867288 12:64569339-64569361 CGCTGCAGCCTCAGCTTGGCTGG + Intergenic
1101716662 12:107318525-107318547 CGCCGCCGCCGCAGCTCCGCGGG - Exonic
1102646845 12:114409193-114409215 GGCTCCCGCCGCAGCTCTGCCGG - Intergenic
1103060458 12:117854429-117854451 CGCTGCCTTCTCAGCCCTGCTGG + Intronic
1103500778 12:121400187-121400209 CGCGACCGCCTCAGCTCGGCCGG - Exonic
1103764124 12:123269804-123269826 CGCTGCCGCCGCTGCTCCTCCGG - Intronic
1104918262 12:132277652-132277674 CCCCGCGGCCCCGGCTCTGCTGG + Intronic
1105385757 13:19928079-19928101 CGCTGCAGCCTCGACTTTCCAGG + Intergenic
1105389263 13:19959354-19959376 GGCTGCTGCCTCTGCTCCGCCGG + Intronic
1105411444 13:20174730-20174752 CGCTGCCCCCTGGCCTCAGCTGG + Intergenic
1106405786 13:29471715-29471737 TGCTCCAGCCTCTGCTCTGCAGG + Intronic
1110596592 13:77326794-77326816 CGCCGCCGCCTCGTCCCCGCGGG + Intronic
1112422837 13:99268530-99268552 CACTGCAGCCTCGGCCCTCCAGG - Intronic
1112561725 13:100521311-100521333 CGCTGCCGGCTCGGGACTTCAGG - Intronic
1113542118 13:111116469-111116491 TCCTGCCTCCTCGGCCCTGCTGG - Intronic
1113803147 13:113096727-113096749 GGCTTCGGCGTCGGCTCTGCCGG - Intronic
1118319276 14:64743629-64743651 CCCTGCTGGCTCGGGTCTGCCGG - Exonic
1118776953 14:68979190-68979212 CGGTTCCGCCGCGGCGCTGCTGG + Exonic
1120521226 14:85530309-85530331 AGATGCCGCCTCGCCGCTGCTGG - Exonic
1121137207 14:91509895-91509917 CGCGGCCCCCTCGGGGCTGCCGG - Exonic
1122208442 14:100159836-100159858 CGCGGCCACCTCGGTCCTGCCGG - Exonic
1122599851 14:102915762-102915784 CGCTGCCACCCTTGCTCTGCAGG + Intergenic
1122736649 14:103847424-103847446 AGCTGCCGCCTCGCCGCGGCCGG - Exonic
1122859951 14:104578035-104578057 CACTCCAGCCTGGGCTCTGCAGG - Intronic
1122896616 14:104760742-104760764 CGCTGCCCCCTCGGGCCTGTCGG + Intronic
1123019895 14:105392774-105392796 GGCTGCAGCCTCGCCGCTGCTGG - Exonic
1123126028 14:105946873-105946895 CCCTGCAGCCTGGGCTGTGCAGG - Intergenic
1123393220 15:19899167-19899189 CCCCGCCGCCGCGGCTCTGAGGG + Intergenic
1123406614 15:20023295-20023317 CCCTGCAGCCTGGGCTGTGCAGG - Intergenic
1123515944 15:21029943-21029965 CCCTGCAGCCTGGGCTGTGCAGG - Intergenic
1124133052 15:27007153-27007175 CACTGCAGCCTCTGCTCTCCAGG + Intronic
1124940040 15:34209823-34209845 CGCGGCGGCCTCGGCTCGGCCGG - Intronic
1129644737 15:77419832-77419854 CGCCGCCGCCGGGGCTCTGGCGG - Intronic
1129983712 15:79897291-79897313 CGCTGCCGCCTCCGCGGTCCCGG - Intronic
1130076692 15:80695621-80695643 CGCCGCCGCCGCGGCCCAGCCGG + Exonic
1130370891 15:83284595-83284617 CGCGTCCGCCCCGGCTCGGCGGG + Exonic
1132153271 15:99477096-99477118 CGCTCCCGCCTGGGCCCTGGTGG + Intergenic
1132449932 15:101961593-101961615 CGCCGCCGCTTCCGCTCTGCCGG - Intergenic
1132845628 16:1999662-1999684 AACTGGCCCCTCGGCTCTGCTGG + Exonic
1133385824 16:5369612-5369634 AGCTGCCTCCTCTGCTATGCTGG + Intergenic
1136408765 16:30064742-30064764 CGCTGCTGACCAGGCTCTGCCGG + Intronic
1136699215 16:32116533-32116555 CCCCGCCGCCGCGGCTCTGAGGG + Intergenic
1136768438 16:32811401-32811423 CCCCGCCGCCGCGGCTCTGAGGG - Intergenic
1136799706 16:33059704-33059726 CCCCGCCGCCGCGGCTCTGAGGG + Intergenic
1136902136 16:34050968-34050990 CCCAGCCGCCGCGGCTCTGAGGG + Intergenic
1137988718 16:53131323-53131345 CGCCGCCGCCGCTGCTCGGCCGG + Intronic
1138283308 16:55788957-55788979 CACTGCACCCTCGGCTCAGCAGG - Intergenic
1138285693 16:55808030-55808052 CACTGCACCCTCGGCTCAGCAGG + Intronic
1203070830 16_KI270728v1_random:1073417-1073439 CCCCGCCGCCGCGGCTCTGAGGG - Intergenic
1143202673 17:5123112-5123134 CGCTGCCGCCGCCCCTCTGACGG - Intronic
1144873669 17:18385310-18385332 CGCTGCCCCCTCGGTTCGGGAGG + Intronic
1145077465 17:19867676-19867698 CGAAGCGGCCTCGGCGCTGCCGG + Exonic
1147168334 17:38604898-38604920 CCCTGCCCCCTGGCCTCTGCAGG + Intronic
1148090716 17:45021103-45021125 GGGTGCAGCCTCAGCTCTGCAGG + Intergenic
1151706671 17:75772779-75772801 TGCTGCAGCCTCTGCTCTACTGG + Intergenic
1151870099 17:76830745-76830767 GGCTGCTGCCTCGTCTCTACTGG + Intergenic
1152953139 18:12337-12359 CGCTGCCCACCCGGCGCTGCAGG + Intergenic
1154518343 18:15197904-15197926 CCCCGCCGCCGCGGCTCTGAGGG - Intergenic
1156385588 18:36601939-36601961 GACTGCTGCCTGGGCTCTGCAGG - Intronic
1160635322 19:70954-70976 CGCCGCCGCTTCCGCTCTGCCGG + Intergenic
1160792221 19:928074-928096 CCCTGCCTCCTCGTCTCTCCAGG + Intronic
1160858277 19:1227067-1227089 CGCGGCCTCCATGGCTCTGCCGG + Intronic
1160913757 19:1487313-1487335 CCCTCCCGCCCTGGCTCTGCAGG - Exonic
1161072457 19:2269712-2269734 TGCTGCCGCCGCGGCTGTGCAGG - Exonic
1161250077 19:3275762-3275784 CCCTGCCGCCTCCACTCTGCTGG + Intronic
1161270095 19:3385029-3385051 CCCTCCCGCCTCTGCTCAGCAGG + Intronic
1161320061 19:3637000-3637022 CGCTGAGGCCTCGGCTCCCCTGG - Intronic
1161399398 19:4060709-4060731 CGATGCAGCCTCCTCTCTGCCGG - Intronic
1162398326 19:10430715-10430737 CCCTGTCGCCTCGGCCCTTCCGG - Intronic
1163517945 19:17776088-17776110 CGCTGCTGCCTCGGGGCTGCAGG - Exonic
1165956954 19:39507077-39507099 CGCTGCCGCGCCGGCTTCGCGGG + Exonic
1165962302 19:39545343-39545365 CGCTGCAGCCTCCGCTCTTCAGG + Intergenic
1166883068 19:45940582-45940604 CGCCGCCGCCTCCGGCCTGCTGG - Exonic
1167747360 19:51359941-51359963 CGCTGCAGCCTCGACCCTCCTGG - Intronic
1202680248 1_KI270712v1_random:2852-2874 CCCCGCCGCCACGGCTCTGAGGG - Intergenic
1202695785 1_KI270712v1_random:124660-124682 GGCTGCTGCCTCGGTTGTGCCGG - Intergenic
925398945 2:3558190-3558212 CCCTGCCGCCGCGGCTCTCGCGG - Exonic
925919052 2:8626695-8626717 CTCTGCCGCCTCGTCTCAGCTGG - Intergenic
927857796 2:26538121-26538143 TGCAGCCTCCTCAGCTCTGCTGG + Intronic
928176328 2:29036714-29036736 CGCTGCTGCCGTGGCTGTGCTGG + Exonic
929456371 2:42068978-42069000 TGCTGCTGCCTGGGCTCTGGAGG - Intergenic
931529714 2:63199915-63199937 CTCTGCCCCTTTGGCTCTGCAGG - Intronic
933070952 2:77857432-77857454 CTCTGCCCCTTTGGCTCTGCAGG - Intergenic
934276947 2:91581698-91581720 GGCTGCTGCCTCGGTTGTGCCGG - Intergenic
934648711 2:96074384-96074406 CGCTGCCTCCTCGGCAATGCAGG + Intergenic
936566157 2:113584088-113584110 CGCCGCCGCTTCCGCTCTGCCGG - Intergenic
937986970 2:127642306-127642328 CGCTGCCGCCTCGGCTCTGCAGG - Intronic
938338529 2:130520225-130520247 CTCTGCCCACTCGGGTCTGCTGG + Intergenic
938351310 2:130600525-130600547 CTCTGCCCACTCGGGTCTGCTGG - Intergenic
939434196 2:142152921-142152943 CGCTGCAGCCTCGACTTTCCAGG + Intergenic
939852991 2:147321765-147321787 CTCTGCCTCTGCGGCTCTGCAGG - Intergenic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
944495704 2:200306065-200306087 CGCCGCCTCCTCTGCGCTGCGGG - Exonic
944509100 2:200446661-200446683 TCCTGCCACCTCGGTTCTGCTGG + Intronic
946692538 2:222320011-222320033 GGCTGCTGCTTGGGCTCTGCTGG + Intergenic
946921450 2:224585237-224585259 CGCTGGCGCGGCGGCTCCGCGGG + Exonic
947157609 2:227178305-227178327 CGCTGTAGCCTCCACTCTGCAGG - Intronic
948510307 2:238459475-238459497 CGCAGCCGCCTGGTCTTTGCTGG + Intergenic
948667610 2:239546181-239546203 CCCTGCCTCCTCGGCTCCCCTGG + Intergenic
948722583 2:239910957-239910979 GGCTGCAGCCTCCTCTCTGCCGG - Intronic
948939078 2:241187334-241187356 TCCTGCCGCCCAGGCTCTGCTGG + Intergenic
1169156417 20:3334247-3334269 CACTGCCGCCTCAGCTCCACTGG + Intronic
1169193745 20:3672769-3672791 CGGTGCCGCCGGCGCTCTGCGGG - Exonic
1170873641 20:20231459-20231481 CACTGGCTCCTCGGCTCTGCTGG - Intronic
1171346724 20:24470857-24470879 CGCTGGCGCCGCGGCGCTCCTGG + Intronic
1172100887 20:32483549-32483571 CGCTGCCGCCGCTGCTCGCCTGG - Intronic
1175429303 20:58891088-58891110 CTCTCCCCCCTCGGCTCAGCCGG + Intronic
1175896432 20:62337857-62337879 CGCTGCCGCCCCGGCTACACAGG - Exonic
1178311904 21:31536643-31536665 CCCTGCCCACTCAGCTCTGCTGG - Intronic
1179405469 21:41122136-41122158 CGCAGCCCCCTGTGCTCTGCAGG + Intergenic
1180354312 22:11825668-11825690 TGCGGCCGCCTCGGCTTGGCTGG - Intergenic
1180383941 22:12166687-12166709 TGCGGCCGCCTCGGCTTGGCTGG + Intergenic
1180715875 22:17871981-17872003 CGCTGCCTCCCAGGTTCTGCGGG + Exonic
1180938636 22:19642247-19642269 CGCTGCTGCGTGGGCACTGCAGG - Intergenic
1183370293 22:37428014-37428036 CCCTGCCGCCTGCGCCCTGCTGG + Intergenic
1183978056 22:41524596-41524618 CACTGCCGGCCCGGCCCTGCAGG + Intronic
1184047667 22:41981623-41981645 CCCTCCCACCTTGGCTCTGCAGG + Exonic
1185070663 22:48654103-48654125 CGTTGGCGCCGCGGCTCTGGAGG + Intronic
1185280030 22:49966072-49966094 CTCTGCTGCTTTGGCTCTGCTGG + Intergenic
950319284 3:12035253-12035275 CCCTGCCCCCTTGGCTTTGCTGG + Intronic
954718005 3:52536445-52536467 CGCAGGCGCCTCAGCTCTGGAGG - Intronic
956681454 3:71785272-71785294 CGCGCCCGCCTCGGCCCGGCCGG + Intergenic
957878851 3:86184030-86184052 CACTGCCACCTCACCTCTGCTGG + Intergenic
958935410 3:100250812-100250834 CTCTGCCTCCATGGCTCTGCAGG + Intergenic
960538392 3:118838845-118838867 CTCTGCCCCCATGGCTCTGCAGG + Intergenic
962253537 3:133854458-133854480 CTCTCCCTCCTCGGCTGTGCTGG + Intronic
963081876 3:141402323-141402345 CGCCGGCGGCTCGGCTCTGCCGG - Intronic
966964911 3:184981376-184981398 CGCTGCCACCCCACCTCTGCTGG - Intronic
968728086 4:2257440-2257462 GGCTGCAGGCTCAGCTCTGCTGG - Intronic
968896570 4:3407455-3407477 CGGGGCCGCCCGGGCTCTGCCGG + Intronic
969405222 4:6987144-6987166 CGCTGCCGGCTCGGCGCGTCAGG - Intronic
969437690 4:7198202-7198224 CGTGGCTGCCCCGGCTCTGCAGG + Intronic
973842872 4:54880332-54880354 CTCTGCCTCCTCAGCTCTGAAGG - Intergenic
975219836 4:71801423-71801445 CTCTGCCTCCTCGGCTCAGTGGG + Intronic
980541441 4:134201532-134201554 CGCCGCCGCCGAGGCGCTGCCGG + Intronic
981616237 4:146647742-146647764 CGGTGCCGCCTGAGCTCCGCAGG - Intergenic
985368543 4:189260475-189260497 CTCTGCCCCTTTGGCTCTGCAGG + Intergenic
985682973 5:1266094-1266116 GGCTGCCGCCTCGGCCCTGCAGG + Intronic
987258362 5:16179774-16179796 AGCCGCCGGCTCGGCTCTGATGG + Exonic
987492052 5:18593958-18593980 CTCTGCCCCTTTGGCTCTGCAGG + Intergenic
987861917 5:23500155-23500177 CTCTGCCCCTTGGGCTCTGCAGG + Intergenic
991965921 5:72091060-72091082 CACTGCAGCCTCGGCTCCCCTGG + Intergenic
995354519 5:111223634-111223656 CACTGCCTCCTCGGCACTGCTGG - Intronic
998193018 5:140042864-140042886 TGCTGCGGCCGCGGCTCTGGGGG + Exonic
998428938 5:142053937-142053959 CTCTGCCGCCTGTGCTCTGGAGG + Intergenic
998814608 5:146000236-146000258 CCCAGCCGCCCCCGCTCTGCAGG + Exonic
999322650 5:150624850-150624872 CGCCGCCGCCTCGGCACACCTGG - Intronic
999730324 5:154472757-154472779 CGCTGCCACCCTGGCTCTCCAGG - Intergenic
999731719 5:154480172-154480194 CGCTGCTGCGGCGGCTCTGCGGG + Intergenic
1002070132 5:176674157-176674179 CCCTGCCCCCTTGGCTGTGCTGG - Intergenic
1002631818 5:180587085-180587107 CGCTGCAGCCTCGACTTTCCGGG + Intergenic
1003948164 6:11094017-11094039 TGCCGCGGCCTCGGCTCTCCGGG + Exonic
1005636434 6:27757610-27757632 CGCGGCGGCCTCTGCTCTGCAGG - Intergenic
1007406938 6:41640663-41640685 CGCTGCCCCAGGGGCTCTGCTGG + Intronic
1009680061 6:66880800-66880822 CCCTGCCCCTTTGGCTCTGCAGG + Intergenic
1013117652 6:107115046-107115068 CGCTGCCGCCGCCGCGCGGCCGG + Intronic
1013803330 6:113970965-113970987 TGCTGCCGCCGCGGCTCGGCCGG + Exonic
1014947481 6:127515639-127515661 CGCTGCCCTCTGCGCTCTGCTGG + Exonic
1016329736 6:142944582-142944604 CTCTGCCGCGGCGGCACTGCCGG - Intronic
1019114729 6:169751227-169751249 TGCTGCCTCCTTGGCTCTGGGGG + Intronic
1019435474 7:1020240-1020262 CGCTGCAGCCTCTGCCCTCCTGG + Intronic
1019559412 7:1648486-1648508 CTCTGCCGGCTCCGCTCCGCAGG - Intergenic
1019578111 7:1747198-1747220 CGCTCCCCCCTCGCCTCTGCAGG - Exonic
1020037641 7:4974356-4974378 CGCTCCCGCCTCGCCACCGCAGG - Intergenic
1020098646 7:5382294-5382316 CACTGCCGCCCCCTCTCTGCAGG + Intronic
1020194069 7:6023583-6023605 CACTGCAGCCTCCGATCTGCTGG - Exonic
1021555800 7:21916408-21916430 CGCCGCAGCCTCGCCTCTGTGGG + Intronic
1022427950 7:30285542-30285564 CGCGGCCGCCGCGGCGCCGCCGG - Exonic
1023039703 7:36161377-36161399 CGCTGTCTGCTTGGCTCTGCAGG + Intronic
1025306720 7:57868140-57868162 CCCCGCCGCCGCGGCTCTGAGGG - Intergenic
1025561961 7:62380611-62380633 CCCCGCCGCCGCGGCTCTGAGGG + Intergenic
1029223134 7:99005917-99005939 CGCTGGCGCCCAGGCTCGGCCGG - Intronic
1029547282 7:101217125-101217147 CTCTGCCCCCTCGGCCGTGCCGG + Intronic
1034217494 7:149419853-149419875 CACTGCAGCCTCGACTCTCCAGG - Intergenic
1034291596 7:149936862-149936884 CACTGCCGCCTTGACCCTGCTGG + Intergenic
1034814495 7:154160032-154160054 CACTGCCGCCTTGACCCTGCTGG - Intronic
1035280488 7:157775463-157775485 CGCTGCCGCCTCCGCCCTGTGGG - Intronic
1037884541 8:22589312-22589334 CGCTGGCGACTCGGCGGTGCTGG + Exonic
1039892535 8:41694975-41694997 TGCAGCCGCATCTGCTCTGCTGG - Intronic
1049219041 8:141420532-141420554 CCCTGCCGCCTCCCCTCTTCAGG + Intronic
1049589230 8:143448589-143448611 CTCCGCCGCCATGGCTCTGCAGG + Intronic
1052888894 9:33677197-33677219 CGCCGCCGCCGCGCCTCAGCCGG + Intergenic
1054785081 9:69202730-69202752 CTCTGCCGCCTGGGCACAGCAGG - Intronic
1056170458 9:83980174-83980196 CGCTGCCGCGCCGCCTCAGCCGG + Exonic
1056451510 9:86721664-86721686 GGCTGCAGACTCTGCTCTGCTGG - Intergenic
1056810984 9:89763757-89763779 CGCTGCTGCCTTGGCCCTGTGGG - Intergenic
1057181414 9:93032810-93032832 CTCTGCAGACACGGCTCTGCCGG - Exonic
1057190155 9:93082864-93082886 CGCTGCCGCAGGGGCTTTGCTGG + Intronic
1058385412 9:104429742-104429764 CTCTGCCTCTGCGGCTCTGCAGG - Intergenic
1060700630 9:125747000-125747022 CGCCGCCGCCTCGGCCAGGCGGG - Intergenic
1061283642 9:129610582-129610604 CGCCTCCGCCTCCGCGCTGCTGG - Intronic
1061786403 9:133031054-133031076 CGCTCCCGCCTCAGCTCCACGGG - Exonic
1061805641 9:133136292-133136314 CGCTGCCCCCTCAGCCCTCCTGG - Intronic
1062349647 9:136132682-136132704 CGCTGGGGCCGCGGCTCGGCTGG + Intergenic
1062499537 9:136846321-136846343 CGCGGGCTCCTCGGCGCTGCCGG - Exonic
1062499961 9:136848072-136848094 CGCTGCAGTCTGGGCCCTGCAGG + Exonic
1202800250 9_KI270719v1_random:169505-169527 TGCGGCCGCCTCGGCTTGGCCGG + Intergenic
1203697561 Un_GL000214v1:112985-113007 TGCGGCCGCCTCGGCTTGGCTGG + Intergenic
1189262524 X:39688870-39688892 CGCCGCCGCCGCGGCTCTGCAGG + Intergenic
1191599870 X:62991088-62991110 CACTACTGCCTGGGCTCTGCTGG + Intergenic
1193011941 X:76686651-76686673 CTCTGCCACCTCAGCTCTCCAGG - Intergenic
1193175530 X:78388344-78388366 CTCTGCCCCTTTGGCTCTGCAGG + Intergenic
1197726945 X:129782769-129782791 CGCACCCTCCTCTGCTCTGCTGG - Intronic
1197753608 X:129981012-129981034 CGCTGCCGCCGCGCCGCCGCGGG - Intergenic
1200068786 X:153517833-153517855 CGCCGCGGCCTCGGCTCCGGCGG - Intronic