ID: 937987263

View in Genome Browser
Species Human (GRCh38)
Location 2:127643598-127643620
Sequence GACTCTGTAGTGACAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937987263_937987265 25 Left 937987263 2:127643598-127643620 CCAGGAACTGTCACTACAGAGTC 0: 1
1: 0
2: 0
3: 12
4: 133
Right 937987265 2:127643646-127643668 TCTGATGCTACTCGCTGTGTTGG 0: 1
1: 0
2: 1
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937987263 Original CRISPR GACTCTGTAGTGACAGTTCC TGG (reversed) Intronic
900645818 1:3708260-3708282 GTCTCTGGAGTGTCATTTCCAGG + Intronic
901379700 1:8864777-8864799 GACTCTGGAGTCAGATTTCCTGG + Intronic
901749320 1:11396293-11396315 GACTCTGTGGGGCCAGTTCAGGG + Intergenic
902400459 1:16154324-16154346 GTCTCTGGAGTGACAGGGCCCGG - Intronic
910688220 1:89939821-89939843 GGCTCTGGAGTGACAGTGCCTGG + Intergenic
917235902 1:172891653-172891675 GACTCTGGAGTCACATTTCCTGG - Intergenic
918521453 1:185419562-185419584 CACTCTGTAGTCAAAGTTGCTGG + Intergenic
920809079 1:209265197-209265219 GACTATTAAGGGACAGTTCCTGG + Intergenic
921932425 1:220765550-220765572 GACTCTCTAGTGACTGGGCCTGG - Intronic
1063247929 10:4242524-4242546 GTCACTGTGGTGACAGTTTCAGG + Intergenic
1066020222 10:31291144-31291166 GGCTCTGTAGCCACAGTACCTGG + Intergenic
1067269248 10:44775294-44775316 GGCTCTGTAGGGACGGTTCTGGG - Intergenic
1068669786 10:59710733-59710755 TACACTGAAGTGACAGGTCCTGG + Intronic
1070613778 10:77953200-77953222 GCACCTGTAGTGCCAGTTCCTGG + Intergenic
1074610285 10:115015096-115015118 TACTCTGTAATGACAGCTCTGGG - Intergenic
1074930351 10:118118862-118118884 GACTCTGAACTCACAGTACCTGG + Intergenic
1076060858 10:127412944-127412966 GACACTGTAGTGACCAGTCCTGG - Intronic
1076388078 10:130073535-130073557 CACTCTTTAGTGGCCGTTCCTGG - Intergenic
1076852439 10:133099686-133099708 GCCTCTGTAGCCACAGCTCCGGG + Intronic
1077909627 11:6562963-6562985 GACTCTGCAGAGACAGATCCAGG - Exonic
1078195359 11:9132692-9132714 GAGACTGTTGTGCCAGTTCCAGG - Intronic
1080702040 11:34652221-34652243 GAACCTGTAGTGATAGTTTCTGG + Intronic
1081623512 11:44633057-44633079 CACTCTGTATTTGCAGTTCCGGG - Intergenic
1083381038 11:62268746-62268768 CACTGTCTAGTGACAGATCCAGG - Intergenic
1088235209 11:107716031-107716053 GGCTCTGTAGTGGCAGTACCTGG - Intronic
1089309435 11:117548074-117548096 TACTCTCTAGGGACAGTACCAGG - Intronic
1089935875 11:122363489-122363511 GACTGTGCACTTACAGTTCCCGG + Intergenic
1091289869 11:134433116-134433138 AACTCTGTGGTCACAGTCCCAGG + Intergenic
1096244068 12:49974624-49974646 GCCTCTGTAGTGCCATATCCTGG - Intronic
1098577814 12:72063651-72063673 GCCTCTGTAGTCACATTGCCTGG + Intronic
1100006159 12:89898007-89898029 GACTCTGATGTGATTGTTCCAGG + Intergenic
1100112325 12:91260625-91260647 GACTCTGTAGTTATAATTCTTGG - Intergenic
1100516775 12:95335769-95335791 TAGTCTGTAGTTACAATTCCAGG - Intergenic
1101579624 12:106031258-106031280 GACTCTGAAGTCACACTGCCTGG - Intergenic
1102396951 12:112594346-112594368 GACTCTGTAGTTAGACTGCCTGG - Intronic
1104287574 12:127439066-127439088 GACTCTTAAGTGGCAGTTCTGGG - Intergenic
1105829217 13:24149499-24149521 GACTCTGAAGAGACAATCCCTGG + Intronic
1109415980 13:62041098-62041120 GTCTCTTTAGTGACATTTCCTGG - Intergenic
1110823378 13:79942532-79942554 CACTCTGTAGTGACAGATTTAGG + Intergenic
1111721477 13:91950903-91950925 GACTCTGTAGCCATAGTCCCTGG - Intronic
1114851097 14:26383364-26383386 GACTCTGTAGTGAGACTACCTGG + Intergenic
1115163300 14:30419676-30419698 GACTCCATAGTTACATTTCCAGG + Intergenic
1116404292 14:44549380-44549402 GCCTCTGAAGTCACAGTGCCTGG - Intergenic
1120360884 14:83500544-83500566 GGGTCTGTAGCTACAGTTCCAGG - Intergenic
1122232992 14:100316369-100316391 GACTCTGAAGGGACAGAGCCAGG + Intergenic
1122298511 14:100718833-100718855 GACTGGGGAGTGACAGTGCCTGG + Intergenic
1122330586 14:100909705-100909727 GACTCTGGAGCGACACTGCCCGG + Intergenic
1126207534 15:46062173-46062195 GTCTTTGAAGTGACATTTCCTGG - Intergenic
1126676077 15:51160262-51160284 GCCTCTGAAGTGACATTGCCAGG + Intergenic
1129838377 15:78727851-78727873 GAAGCAGTAATGACAGTTCCTGG - Intergenic
1135603083 16:23799947-23799969 GACTCTGTACTGGCATTTCATGG + Intergenic
1137734266 16:50712365-50712387 GGCTCTGTAGTGAGTGTTACTGG + Exonic
1139690317 16:68637496-68637518 GACTCTGGAGTCACACTGCCTGG - Intronic
1140440266 16:74982728-74982750 GACTCTGTGCTGACAGTACTTGG + Intronic
1141910379 16:87054442-87054464 GAGTCTGTTGGGACACTTCCGGG + Intergenic
1142035583 16:87860698-87860720 GTCTCAGTAGTGACAGATGCTGG + Intronic
1142135451 16:88449926-88449948 CGCTCTGGAGTGAGAGTTCCTGG + Intergenic
1143089784 17:4442831-4442853 GACTCTGGAGGCACACTTCCTGG - Intronic
1143851422 17:9814973-9814995 CAATCTGAAATGACAGTTCCTGG - Intronic
1149107462 17:52986436-52986458 GACTCTGTTGTGCCTCTTCCTGG - Exonic
1149777791 17:59371546-59371568 GACTCTGCAGAGACAGAGCCTGG - Intronic
1151312748 17:73304138-73304160 GACTCTGCAGTAACTATTCCTGG + Intronic
1151956084 17:77380883-77380905 GACTCTGAATGGGCAGTTCCTGG + Intronic
1155248689 18:23935547-23935569 GACTCTGGAGTCAGACTTCCTGG + Intronic
1156788250 18:40941206-40941228 GACTCTGTAGAGAAAGAGCCAGG - Intergenic
1157314287 18:46575266-46575288 GACCCTGGAGGGACAGTTCATGG - Intronic
1165762799 19:38331847-38331869 GACTCTGGAGGCAAAGTTCCTGG + Intergenic
926148000 2:10408501-10408523 ACCTCTAGAGTGACAGTTCCAGG - Intronic
928445406 2:31329461-31329483 CACTCTGAAGTGACTGTTCTGGG + Intergenic
929379044 2:41327500-41327522 GCCTCTGGAGTGACAGATCAGGG + Intergenic
929400033 2:41568840-41568862 TATGCTGTATTGACAGTTCCTGG + Intergenic
935414263 2:102799189-102799211 GACACTGTAGTGACAGTTGAAGG + Intronic
936089009 2:109488982-109489004 GGCTCTGTACTGACAGTCCATGG - Intronic
937318045 2:120944465-120944487 GACTCTGAAGTCACAGATCTAGG - Intronic
937440313 2:121909609-121909631 GACTCTGGAGTGAGACTGCCTGG - Intergenic
937987263 2:127643598-127643620 GACTCTGTAGTGACAGTTCCTGG - Intronic
939464785 2:142543422-142543444 GACTCTGGAGTAAAAGTCCCTGG + Intergenic
939928636 2:148204511-148204533 GTCTCAGTATTGACAGTTCTAGG - Intronic
941932581 2:170956995-170957017 TACTCTGTGTTGACAGGTCCTGG + Intronic
944584668 2:201163006-201163028 GACTCTGTAATTCCACTTCCGGG - Intronic
946931565 2:224676646-224676668 GCCTCTGGAGTGAGACTTCCTGG - Intergenic
947331069 2:229029879-229029901 GACTCTGTAGTTCCACTTCTGGG + Intronic
1175395928 20:58661696-58661718 GACTCTGAAGTGCCAGGTACTGG + Intronic
1179571888 21:42283387-42283409 AACTCTGAAGTGACAGGCCCGGG - Intronic
1181778189 22:25174961-25174983 GTCTCTGTAGTGGCTCTTCCAGG + Intronic
1183833448 22:40432509-40432531 GACTCTATAGAGTCAGGTCCAGG - Intronic
951666249 3:25127277-25127299 GGCCCAGTAGTGACAGGTCCTGG - Intergenic
955367797 3:58326513-58326535 GTCTCTTTGGGGACAGTTCCTGG - Intergenic
959845772 3:111031620-111031642 AGCTCTGTAGTGACAGATCTTGG + Intergenic
960913770 3:122676993-122677015 GACTCTGTAGCTACATTTCCAGG + Intergenic
967137062 3:186521542-186521564 GACTCTGGAGTCAAAGTTACTGG - Intergenic
968324604 3:197802243-197802265 GATCCTGTATTCACAGTTCCAGG + Intronic
972739871 4:41879132-41879154 GACTCTGTTTTGACAGTAGCTGG + Intergenic
972773050 4:42216007-42216029 GACTCTGAAGTCTTAGTTCCTGG - Intergenic
974345845 4:60679916-60679938 GACTCTGGGGTGACAGATACTGG + Intergenic
976221133 4:82757617-82757639 GACTCTGGAGTGAAAGTGCTGGG + Intronic
977786395 4:101039637-101039659 TACTCTTTAGTGACTGTACCAGG + Intronic
980157923 4:129129353-129129375 TACTCAGTAGTGGGAGTTCCGGG - Intergenic
980877065 4:138672401-138672423 GACCCTGTAGTGCCAAGTCCAGG + Intergenic
981688099 4:147477605-147477627 AAGGCTGTAGTGACAGTTTCAGG + Intergenic
984202684 4:176745494-176745516 CACTTTCTAGTGACAGTTCCTGG - Intronic
989265792 5:39472038-39472060 GACTTTGTGGTAAGAGTTCCAGG + Intergenic
990681356 5:58248218-58248240 GGCTCTGTAGTTAAACTTCCTGG - Intergenic
996684275 5:126263433-126263455 GAGTTTGAAGTGGCAGTTCCAGG + Intergenic
997007766 5:129839630-129839652 GACTCTTTATGGACAGTTCTGGG - Intergenic
998327114 5:141290939-141290961 GACTCTGGAGTAAGAGGTCCAGG + Intergenic
999954289 5:156683707-156683729 GACTGTGTAGTGACAAAGCCAGG - Intronic
1000011094 5:157233568-157233590 GAGTCTCTAGTGTTAGTTCCCGG + Intronic
1000460970 5:161517688-161517710 GCCACTGTAGTCACAGTTCTGGG - Intronic
1000708681 5:164544088-164544110 TATTCTGTAGTGATAGTTTCAGG - Intergenic
1003773151 6:9330492-9330514 GAGTCTGTCGGGACAGTTCCAGG - Intergenic
1007839577 6:44704732-44704754 GACTCTGTAGTCAGGGTCCCGGG - Intergenic
1012050794 6:94341494-94341516 AACACTGTAGTGCCATTTCCTGG - Intergenic
1013056405 6:106587538-106587560 GACTCTGCAGTCACAGTGACTGG - Intronic
1015773842 6:136793742-136793764 GACTCACTAGTCTCAGTTCCTGG - Intergenic
1017835403 6:158172905-158172927 GACTCTGAAGTCTCAGTGCCCGG + Intronic
1021658177 7:22892514-22892536 GACTCTGGAGTGAAACTGCCTGG + Intergenic
1024370954 7:48583164-48583186 GACACAGTAGGGACAGTCCCTGG - Intronic
1025262523 7:57428269-57428291 GACTCTGTAGACACAGATACTGG + Intergenic
1028498645 7:91491962-91491984 GACTCTGTCTTGAAATTTCCTGG - Intergenic
1029040918 7:97573782-97573804 GAATCTGTAATCACAGTTCTTGG + Intergenic
1031761190 7:125715628-125715650 GACTCTGTGGAGACAACTCCCGG - Intergenic
1033158522 7:138976844-138976866 GACTCTTTGGTGGCAGTGCCTGG - Intronic
1038369506 8:26973775-26973797 GGGTCTGTAGTCACACTTCCTGG + Intergenic
1040697367 8:50017145-50017167 GACAATGTAGTAACATTTCCTGG - Intronic
1041491729 8:58440153-58440175 AACTCTGTAGTCAGAGTGCCTGG - Intronic
1044546415 8:93465328-93465350 GCCTGTCTAGGGACAGTTCCTGG + Intergenic
1048798963 8:138178597-138178619 GACTCTGTGGACCCAGTTCCTGG - Exonic
1048978571 8:139690170-139690192 GACTCTGAAGTCAGACTTCCCGG + Intronic
1049671950 8:143873829-143873851 TTCTCTGGAGTGACAGGTCCAGG - Intronic
1051165631 9:14259544-14259566 GACTCTGGAAAGACAGCTCCAGG + Intronic
1054931194 9:70637127-70637149 GACTCTGGAGTCAGAGTGCCTGG + Intronic
1055067682 9:72134865-72134887 AGCTCTGTACTAACAGTTCCAGG - Intronic
1058937026 9:109779282-109779304 GAGTCTTTTGTGACAGGTCCTGG - Intronic
1059053446 9:110953259-110953281 GCCTCAGTAGTGGCAGTTGCAGG - Intronic
1059364090 9:113771890-113771912 GACTCTGGAGTCACACTACCTGG + Intergenic
1187144213 X:16622799-16622821 GACTCTGAAGTCAGACTTCCTGG + Intronic
1187251057 X:17598194-17598216 GACTCTTTTGTGGCAGTTCCTGG + Intronic
1187997570 X:24945006-24945028 GTCTCTGGAGTGAGAGTGCCAGG + Intronic
1190116336 X:47628129-47628151 GACCCTGGAGTGGCAGCTCCAGG - Exonic
1191757681 X:64611732-64611754 ACCTCTGTGGTGCCAGTTCCTGG - Intergenic
1196290837 X:113939184-113939206 TACTCTGGAGTGAAACTTCCTGG - Intergenic
1197715310 X:129702107-129702129 GAGTCTGTAGAGACAGTACAGGG + Intergenic
1198266671 X:135015913-135015935 GTCTCTCTGGTGACAGTTTCAGG - Intergenic
1198997984 X:142597476-142597498 AAGTCTGTAGTGACACTTCCAGG + Intergenic
1199030457 X:142992730-142992752 GACTCTGAAGTTAGATTTCCTGG - Intergenic