ID: 937988748

View in Genome Browser
Species Human (GRCh38)
Location 2:127650593-127650615
Sequence GGCGGTGCTGAGCTTGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937988741_937988748 -5 Left 937988741 2:127650575-127650597 CCCCTCAGCAGCCCCGTGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 212
Right 937988748 2:127650593-127650615 GGCGGTGCTGAGCTTGAAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 127
937988744_937988748 -7 Left 937988744 2:127650577-127650599 CCTCAGCAGCCCCGTGGGCGGTG 0: 1
1: 0
2: 0
3: 19
4: 211
Right 937988748 2:127650593-127650615 GGCGGTGCTGAGCTTGAAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 127
937988743_937988748 -6 Left 937988743 2:127650576-127650598 CCCTCAGCAGCCCCGTGGGCGGT 0: 1
1: 0
2: 0
3: 12
4: 118
Right 937988748 2:127650593-127650615 GGCGGTGCTGAGCTTGAAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 127
937988738_937988748 13 Left 937988738 2:127650557-127650579 CCAAATGGACAAGGAGGTCCCCT 0: 1
1: 0
2: 0
3: 9
4: 104
Right 937988748 2:127650593-127650615 GGCGGTGCTGAGCTTGAAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937988748 Original CRISPR GGCGGTGCTGAGCTTGAAAG TGG Intronic