ID: 937988808

View in Genome Browser
Species Human (GRCh38)
Location 2:127650962-127650984
Sequence GACCAGCACGCACGACAAGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 25}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937988808_937988809 -7 Left 937988808 2:127650962-127650984 CCGACTTGTCGTGCGTGCTGGTC 0: 1
1: 0
2: 1
3: 1
4: 25
Right 937988809 2:127650978-127651000 GCTGGTCCTGCCCACCCGCCTGG 0: 1
1: 0
2: 1
3: 37
4: 250
937988808_937988815 9 Left 937988808 2:127650962-127650984 CCGACTTGTCGTGCGTGCTGGTC 0: 1
1: 0
2: 1
3: 1
4: 25
Right 937988815 2:127650994-127651016 CGCCTGGTCTACCACTTCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 63
937988808_937988818 19 Left 937988808 2:127650962-127650984 CCGACTTGTCGTGCGTGCTGGTC 0: 1
1: 0
2: 1
3: 1
4: 25
Right 937988818 2:127651004-127651026 ACCACTTCTCTGGGAACCACTGG 0: 1
1: 0
2: 2
3: 20
4: 162
937988808_937988821 28 Left 937988808 2:127650962-127650984 CCGACTTGTCGTGCGTGCTGGTC 0: 1
1: 0
2: 1
3: 1
4: 25
Right 937988821 2:127651013-127651035 CTGGGAACCACTGGCCATTTGGG 0: 1
1: 0
2: 1
3: 16
4: 191
937988808_937988820 27 Left 937988808 2:127650962-127650984 CCGACTTGTCGTGCGTGCTGGTC 0: 1
1: 0
2: 1
3: 1
4: 25
Right 937988820 2:127651012-127651034 TCTGGGAACCACTGGCCATTTGG 0: 1
1: 0
2: 2
3: 15
4: 163
937988808_937988822 29 Left 937988808 2:127650962-127650984 CCGACTTGTCGTGCGTGCTGGTC 0: 1
1: 0
2: 1
3: 1
4: 25
Right 937988822 2:127651014-127651036 TGGGAACCACTGGCCATTTGGGG 0: 1
1: 0
2: 6
3: 45
4: 315
937988808_937988816 10 Left 937988808 2:127650962-127650984 CCGACTTGTCGTGCGTGCTGGTC 0: 1
1: 0
2: 1
3: 1
4: 25
Right 937988816 2:127650995-127651017 GCCTGGTCTACCACTTCTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937988808 Original CRISPR GACCAGCACGCACGACAAGT CGG (reversed) Exonic
914303144 1:146393690-146393712 CACCAGCGCGCACGACGACTAGG - Intergenic
916487242 1:165270789-165270811 GACCAGCACACAGGACAGATGGG + Intronic
919711590 1:200734638-200734660 AACCAGCAAGCACTATAAGTAGG - Intergenic
1076055983 10:127373222-127373244 GACCAGCAGGCACCTCAAGAAGG - Intronic
1100487608 12:95045415-95045437 TACCAGCACACAGGACAAGATGG + Intronic
1103758612 12:123232075-123232097 GCCCATCACCCACGACAAATGGG + Intronic
1105326846 13:19378043-19378065 GACCAGGACTCACGCCAAGGAGG - Intergenic
1105864844 13:24450621-24450643 GACCAGGACTCACGCCAAGGAGG + Intronic
1118318259 14:64738429-64738451 GCCCAACAAGCATGACAAGTGGG + Intronic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1160065105 18:75567013-75567035 GACCAGCACGGACCACAATGAGG + Intergenic
936886672 2:117318827-117318849 CACCTGCACTCAGGACAAGTTGG + Intergenic
937988808 2:127650962-127650984 GACCAGCACGCACGACAAGTCGG - Exonic
939612894 2:144332100-144332122 AACCAGCACGCACGACATGTAGG + Intronic
1170755775 20:19205741-19205763 GACCAGCAGGCACTAGGAGTTGG - Intergenic
1172311755 20:33923751-33923773 GACAAGCTCCCAGGACAAGTTGG - Intergenic
1173767968 20:45631260-45631282 CACCAGGACGCAAGACAAGTGGG - Exonic
1174566683 20:51469768-51469790 GACCAGCAGGCACCAAAAGCTGG + Intronic
963904722 3:150763614-150763636 CACCAGCACGCAGGAGAAGAGGG + Intergenic
968050521 3:195651742-195651764 CTCCAGCACGCAGGCCAAGTGGG + Intergenic
968096801 3:195937117-195937139 CTCCAGCACGCAGGCCAAGTGGG - Intergenic
968105304 3:195996612-195996634 CTCCAGCACGCAGGCCAAGTGGG - Intergenic
968303593 3:197634189-197634211 CTCCAGCACGCAGGCCAAGTGGG - Intergenic
986053826 5:4116071-4116093 TACCAGCACTCACGAGCAGTCGG - Intergenic
1007269000 6:40621333-40621355 GACCAGCACGGCCAACTAGTTGG + Intergenic
1007427595 6:41757456-41757478 GATGAGCACGCACGACAGCTGGG + Intergenic
1013393664 6:109713115-109713137 GACCAGCAGTCACTACACGTTGG - Intronic
1029677438 7:102080071-102080093 GACAAGCAGGCATGACAAGATGG + Intronic