ID: 937993108

View in Genome Browser
Species Human (GRCh38)
Location 2:127675027-127675049
Sequence TGGCAGCGACGCCGAGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 81}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937993094_937993108 22 Left 937993094 2:127674982-127675004 CCCGGCCCGGGGGCGTGGGTGGG No data
Right 937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 81
937993090_937993108 26 Left 937993090 2:127674978-127675000 CCTCCCCGGCCCGGGGGCGTGGG No data
Right 937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 81
937993104_937993108 -9 Left 937993104 2:127675013-127675035 CCTTCCCGTCATGGTGGCAGCGA 0: 1
1: 0
2: 0
3: 3
4: 101
Right 937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 81
937993088_937993108 29 Left 937993088 2:127674975-127674997 CCGCCTCCCCGGCCCGGGGGCGT No data
Right 937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 81
937993092_937993108 23 Left 937993092 2:127674981-127675003 CCCCGGCCCGGGGGCGTGGGTGG No data
Right 937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 81
937993096_937993108 21 Left 937993096 2:127674983-127675005 CCGGCCCGGGGGCGTGGGTGGGG No data
Right 937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 81
937993102_937993108 -3 Left 937993102 2:127675007-127675029 CCGTTACCTTCCCGTCATGGTGG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 81
937993099_937993108 17 Left 937993099 2:127674987-127675009 CCCGGGGGCGTGGGTGGGGGCCG No data
Right 937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 81
937993087_937993108 30 Left 937993087 2:127674974-127674996 CCCGCCTCCCCGGCCCGGGGGCG No data
Right 937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 81
937993100_937993108 16 Left 937993100 2:127674988-127675010 CCGGGGGCGTGGGTGGGGGCCGT No data
Right 937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937993108 Original CRISPR TGGCAGCGACGCCGAGCCCT GGG Intronic
900373568 1:2343365-2343387 TGACAGAGCCGCCGGGCCCTGGG + Intronic
900397165 1:2457802-2457824 TGGGAGCGGCTCCCAGCCCTTGG + Intronic
902514140 1:16980734-16980756 GGGCCGCCACGCCGTGCCCTCGG + Exonic
904782796 1:32963844-32963866 TAGCAGCCACCTCGAGCCCTGGG + Intronic
906690991 1:47792723-47792745 TGGTAGCTACCCCCAGCCCTGGG + Intronic
907249856 1:53130831-53130853 AGGCAGGGACACCCAGCCCTGGG + Intronic
922208131 1:223466900-223466922 TGCCAGAGACGCCTGGCCCTGGG + Intergenic
1063360096 10:5446560-5446582 TGGCCCCGCCCCCGAGCCCTGGG + Intronic
1064423752 10:15212645-15212667 TGGCGGATACGCCGAGTCCTCGG + Exonic
1066110180 10:32188766-32188788 TGCCATCGACGGCGAGCCCTTGG - Intergenic
1067171348 10:43909300-43909322 TGGCATAGACGGCGAGCCCAGGG + Intergenic
1072951014 10:99846785-99846807 TGGTAGCCACTCCGAGCCTTAGG + Intronic
1076993717 11:288766-288788 TCGGAGCGCCCCCGAGCCCTCGG + Intergenic
1077362692 11:2147729-2147751 TGGCAGCGATTCAGAGCCCTGGG + Exonic
1077402599 11:2366544-2366566 TGCCAGGGACGCCCAGCCCCTGG - Intergenic
1087176928 11:95104841-95104863 TGGCAGCCAGGCTGAGCCATGGG - Intronic
1090330929 11:125931763-125931785 TGGCAGCGACTCTGAGCTCTAGG + Intergenic
1093329139 12:17813791-17813813 TGGCAGAGACACAGAGCTCTGGG + Intergenic
1106036749 13:26051123-26051145 AGGCGACGACGCCGGGCCCTAGG + Intergenic
1107947882 13:45436198-45436220 TGCCATCGACGGCGAGCCCTTGG + Intergenic
1116844670 14:49853909-49853931 TTGCAGCGACGCCGAGCGCCGGG - Intergenic
1119712393 14:76831503-76831525 TGGCAGCCAAGCAGAGCCCAGGG - Intronic
1123630636 15:22257882-22257904 AGGCTGCGACGCCGCGCCCGCGG + Intergenic
1124372400 15:29111147-29111169 GGGCAGAGACACCGAGCCGTGGG - Intronic
1126150974 15:45523059-45523081 TAGCAGCAACGCCCAGCCCCCGG - Intergenic
1129260138 15:74361580-74361602 TCGCAGTCACGGCGAGCCCTTGG + Intronic
1130910171 15:88265349-88265371 TGTCAGGGACACTGAGCCCTGGG - Intergenic
1135525350 16:23209858-23209880 TGGCAGGGGCACCCAGCCCTGGG + Intronic
1138450644 16:57092132-57092154 TGGGAGCGGCGCTGCGCCCTCGG - Intergenic
1141701153 16:85642732-85642754 TTGCAGCGGGGCCGGGCCCTGGG + Intronic
1141972450 16:87492752-87492774 AGGCGGCGACGCCGCGCCCGCGG - Intergenic
1142651037 17:1352142-1352164 AGGCAGCTACTCCCAGCCCTTGG - Intronic
1142744319 17:1948139-1948161 TGGCAGGGACCCTCAGCCCTGGG - Intronic
1148899547 17:50865963-50865985 CTGCAGCGGCGTCGAGCCCTGGG - Intronic
1152209795 17:78997028-78997050 AGGCAGCAAAGCCGTGCCCTGGG - Exonic
1153284809 18:3448232-3448254 TCGCAGCGTCGCCCAGCCCCCGG + Intronic
1163298242 19:16426283-16426305 TGGCAGCCAGGCCCAGGCCTAGG + Intronic
1166321928 19:42023960-42023982 TGGCAGGGCAGCTGAGCCCTAGG - Intronic
1166805835 19:45486351-45486373 TGGCAGTGAGGCCGTGTCCTGGG + Intronic
1166983913 19:46648796-46648818 GGGCAGCGACTCCGAGTGCTCGG - Exonic
1167343961 19:48933700-48933722 TGGTTGCGATGCGGAGCCCTCGG - Exonic
1167426567 19:49432690-49432712 GGGCAGAGACGCCGAGCCGGCGG - Intronic
1168332393 19:55578185-55578207 TGGCGGCGACGTCGGGGCCTGGG + Exonic
928313685 2:30230923-30230945 TGGCAGAGACGCGGAGCCGGGGG - Intergenic
935592574 2:104855669-104855691 GGGCAGCGCCGCCGTGACCTCGG + Exonic
937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1174475163 20:50791078-50791100 TGGCAGCGCGGCGGAGCCCCTGG + Intergenic
1176230622 20:64030946-64030968 TGGCAGCAACGCAGAGTCCCGGG + Intronic
1177271759 21:18857808-18857830 TGCCGTCGACGGCGAGCCCTTGG + Intergenic
1179565156 21:42243018-42243040 TGGGAGCCACCCTGAGCCCTGGG + Intronic
1184523758 22:45009734-45009756 GCGCCGCGGCGCCGAGCCCTCGG + Intronic
1184773998 22:46614268-46614290 TGGCAGCAGCGCCCCGCCCTTGG - Intronic
1185161514 22:49232779-49232801 TGGCAGCGGTGCCGAGCACAGGG + Intergenic
949483163 3:4512944-4512966 TGTCAGCAGAGCCGAGCCCTCGG + Intronic
950587399 3:13904315-13904337 TGGCAGCCACCCCTACCCCTGGG - Intergenic
953657020 3:44862107-44862129 CGGCAGCGAGGTCGAGCCCGGGG + Exonic
962804182 3:138915503-138915525 TGGCAGCGACGGCTCTCCCTTGG + Intergenic
963040520 3:141066503-141066525 AGGCAGTGACGCCGAGTCGTGGG + Exonic
967200268 3:187066761-187066783 TGGCAGAGCAGCAGAGCCCTGGG - Intronic
968230546 3:197002770-197002792 TGGGAGGGAGGCCGAGCCCGGGG - Exonic
977231000 4:94451770-94451792 TGGCGGCGGCGCCGGGCGCTCGG - Intergenic
980937791 4:139242656-139242678 TGGCAGGGAGGCAGAGCCCCCGG + Intergenic
981004375 4:139860187-139860209 TGGAAGCGACTCCGACCCCACGG - Intronic
985785273 5:1890002-1890024 CGGCAGCGTGGCCAAGCCCTGGG - Intergenic
997652823 5:135535132-135535154 CGCCAGCGACGCGGAGTCCTGGG - Exonic
1014632525 6:123803871-123803893 TGGCAGCGCCGCCGCGCCCTCGG - Intergenic
1018207611 6:161450224-161450246 TGGCAAAGACGCTGAGCCTTAGG + Intronic
1019746782 7:2705247-2705269 TGGGAGGGATGCGGAGCCCTGGG - Intronic
1022090214 7:27103179-27103201 TGGCTGGGACGCAGGGCCCTCGG - Intergenic
1023945069 7:44796754-44796776 TGCCGTCGACGGCGAGCCCTTGG + Exonic
1024436779 7:49365826-49365848 TGGCAGCCACCCCCTGCCCTGGG + Intergenic
1033655876 7:143373913-143373935 TGGCAGAGACACAGAGGCCTGGG + Intergenic
1037313233 8:17577520-17577542 TGGCAGCTACCCCGACCCTTAGG + Intronic
1038133389 8:24758991-24759013 TGGCAGAGGCTCAGAGCCCTTGG - Intergenic
1039463135 8:37762632-37762654 GGGGACCGACGCCGAGCCCCAGG - Exonic
1049214927 8:141403114-141403136 GGTCAGAGACGCAGAGCCCTGGG + Intronic
1049452035 8:142667153-142667175 TGGCAGCACCTCCTAGCCCTTGG - Intronic
1049672942 8:143877817-143877839 GGGCAGGGAAGCAGAGCCCTGGG + Intronic
1055854611 9:80670507-80670529 TGGCAGAAATGCGGAGCCCTGGG + Intergenic
1057008924 9:91584423-91584445 TGGCAGTGACGGGGAGCCCTGGG - Intronic
1057489138 9:95508328-95508350 TGGTAACGCCGCCGAGCCCCAGG - Exonic
1060794594 9:126505220-126505242 TGGCAGCGCCGCTGGACCCTAGG + Exonic
1062209739 9:135357060-135357082 TGGCAGCCACCCTGGGCCCTGGG - Intergenic
1185575745 X:1170841-1170863 TGGCACCACCGCCCAGCCCTAGG - Intergenic
1195964685 X:110419216-110419238 TGGCTGAGACACAGAGCCCTAGG - Intronic
1199978617 X:152908753-152908775 TGGCTGGGACTCAGAGCCCTGGG + Intergenic
1200215830 X:154367868-154367890 TGGCAGAGCGGCCGGGCCCTGGG - Exonic
1201499650 Y:14627786-14627808 TGGAATGGACGCCGAGGCCTAGG + Intronic